Incidental Mutation 'R0925:H2-M11'
ID83172
Institutional Source Beutler Lab
Gene Symbol H2-M11
Ensembl Gene ENSMUSG00000037537
Gene Namehistocompatibility 2, M region locus 11
Synonyms
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36547075-36549250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36547461 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 49 (V49A)
Ref Sequence ENSEMBL: ENSMUSP00000042522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041964]
Predicted Effect probably benign
Transcript: ENSMUST00000041964
AA Change: V49A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000042522
Gene: ENSMUSG00000037537
AA Change: V49A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.8e-44 PFAM
IGc1 222 293 1.91e-18 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173968
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Cdh11 T A 8: 102,634,724 I661L probably damaging Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in H2-M11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:H2-M11 APN 17 36547553 missense probably benign 0.00
IGL01657:H2-M11 APN 17 36547573 missense probably benign 0.00
IGL02249:H2-M11 APN 17 36547937 missense probably benign 0.39
IGL03263:H2-M11 APN 17 36548913 missense probably damaging 1.00
R0481:H2-M11 UTSW 17 36548954 nonsense probably null
R0639:H2-M11 UTSW 17 36547391 missense probably benign 0.00
R0866:H2-M11 UTSW 17 36548937 missense probably benign 0.00
R0924:H2-M11 UTSW 17 36549214 missense probably benign
R1707:H2-M11 UTSW 17 36548766 missense probably damaging 1.00
R2212:H2-M11 UTSW 17 36548930 missense probably damaging 1.00
R2566:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R2567:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3029:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3030:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R3893:H2-M11 UTSW 17 36547090 missense probably benign 0.01
R3946:H2-M11 UTSW 17 36549231 missense probably damaging 1.00
R4647:H2-M11 UTSW 17 36547991 missense probably benign 0.06
R4679:H2-M11 UTSW 17 36548150 missense possibly damaging 0.76
R4868:H2-M11 UTSW 17 36548919 missense probably damaging 1.00
R4876:H2-M11 UTSW 17 36547509 missense probably benign 0.09
R5496:H2-M11 UTSW 17 36547979 missense possibly damaging 0.73
R6514:H2-M11 UTSW 17 36548947 missense probably damaging 1.00
R7779:H2-M11 UTSW 17 36548806 missense probably benign 0.14
R8072:H2-M11 UTSW 17 36548134 missense probably benign 0.13
R8210:H2-M11 UTSW 17 36547968 missense probably damaging 0.98
R8249:H2-M11 UTSW 17 36549008 missense probably damaging 1.00
Z1176:H2-M11 UTSW 17 36548770 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACCAGTCATCCAGATGGTGAGTGG -3'
(R):5'- AGAACAGTGTCCTATGGCTCCCTTG -3'

Sequencing Primer
(F):5'- CAGCCAGAACCTAGATTTGCTTTAC -3'
(R):5'- CCTTTTCCAGGAGAAAAACATGGTC -3'
Posted On2013-11-08