Incidental Mutation 'R0926:Olfr1156'
ID83182
Institutional Source Beutler Lab
Gene Symbol Olfr1156
Ensembl Gene ENSMUSG00000075144
Gene Nameolfactory receptor 1156
SynonymsMOR174-3, GA_x6K02T2Q125-49433499-49432537
MMRRC Submission 039073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0926 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87947053-87953100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87949922 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 104 (F104I)
Ref Sequence ENSEMBL: ENSMUSP00000149665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099842] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
Predicted Effect probably damaging
Transcript: ENSMUST00000099842
AA Change: F104I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097430
Gene: ENSMUSG00000075144
AA Change: F104I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-47 PFAM
Pfam:7tm_1 41 290 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215903
Predicted Effect probably damaging
Transcript: ENSMUST00000216191
AA Change: F104I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216726
AA Change: F104I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4611 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,549 D514G probably damaging Het
Acbd7 A T 2: 3,340,441 I41F possibly damaging Het
Actr8 G T 14: 29,987,224 V262L probably benign Het
Anp32e A G 3: 95,937,142 D108G probably damaging Het
Banp G A 8: 122,020,555 G448S probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Cd22 C A 7: 30,869,509 probably null Het
Cfap58 A T 19: 47,962,562 Q454L probably damaging Het
Cntn4 C T 6: 106,655,581 T522I probably benign Het
Col11a1 G A 3: 114,090,180 D233N unknown Het
Csmd1 G T 8: 16,033,576 probably null Het
Csmd3 T A 15: 47,977,033 Y946F probably damaging Het
D5Ertd579e G T 5: 36,672,866 P38Q probably damaging Het
Dnal4 T C 15: 79,762,025 T93A probably benign Het
Dsp A T 13: 38,183,218 D614V probably damaging Het
Fam160b1 G A 19: 57,381,090 A383T probably damaging Het
Fcgr1 A T 3: 96,292,366 I75N possibly damaging Het
Fgd6 T A 10: 94,135,047 Y1229N probably benign Het
Frmpd1 T G 4: 45,268,497 L214R probably damaging Het
Gapvd1 A T 2: 34,712,325 D603E probably damaging Het
H2-M9 A G 17: 36,641,773 V127A probably damaging Het
Herc2 T A 7: 56,132,548 S1328T possibly damaging Het
Ica1l T C 1: 60,006,297 N269S probably benign Het
Il18r1 T C 1: 40,487,028 Y245H probably damaging Het
Il6ra A T 3: 89,887,069 V195E probably damaging Het
Inpp5j A G 11: 3,501,439 probably benign Het
Isy1 T C 6: 87,819,143 T271A probably benign Het
Klra9 T C 6: 130,179,030 Y254C probably damaging Het
Ly6e T G 15: 74,958,370 S73A probably damaging Het
Mcmdc2 T A 1: 9,920,576 L326* probably null Het
Muc4 G A 16: 32,756,196 probably benign Het
Myh3 A G 11: 67,090,514 probably null Het
Ndor1 G A 2: 25,248,348 H409Y probably benign Het
Nwd2 A G 5: 63,807,891 D1606G probably damaging Het
Olfr1303 A G 2: 111,814,547 Y60H probably damaging Het
Olfr1451 A T 19: 12,999,190 D68V probably damaging Het
Olfr186 A G 16: 59,027,688 I73T possibly damaging Het
Olfr314 A G 11: 58,787,109 N292D probably damaging Het
Olfr411 G A 11: 74,347,306 R93C probably benign Het
Olfr585 T C 7: 103,097,885 L48P probably damaging Het
Paox C A 7: 140,134,038 T237K probably damaging Het
Pcmtd1 T A 1: 7,161,019 L4I probably damaging Het
Pfkl T A 10: 78,000,689 T165S probably damaging Het
Pik3ap1 A G 19: 41,302,525 S523P probably benign Het
Pitpnm1 A G 19: 4,112,338 D1056G probably damaging Het
Pitpnm2 G A 5: 124,131,209 T450I probably benign Het
Pou2f3 T C 9: 43,146,901 D37G probably damaging Het
Prdm5 A G 6: 65,883,547 H221R probably damaging Het
Pwp1 T A 10: 85,876,514 I72N probably damaging Het
Rhou A G 8: 123,660,976 E149G probably damaging Het
She A G 3: 89,851,594 probably benign Het
Slc26a9 A C 1: 131,753,216 H121P probably benign Het
Spag17 A G 3: 100,072,116 D1431G probably benign Het
Trpm3 A T 19: 22,988,043 D1634V probably benign Het
Ttn A G 2: 76,797,227 probably benign Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Zcrb1 T C 15: 93,391,528 K51E probably damaging Het
Zfp110 C T 7: 12,849,881 Q819* probably null Het
Zfp616 A G 11: 74,085,818 N971S probably benign Het
Zfp827 A T 8: 79,118,192 T664S probably benign Het
Other mutations in Olfr1156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Olfr1156 APN 2 87949863 missense probably damaging 0.99
IGL02831:Olfr1156 APN 2 87949676 splice site probably null
IGL03214:Olfr1156 APN 2 87950071 missense probably benign 0.16
R0285:Olfr1156 UTSW 2 87950131 missense probably damaging 0.98
R0987:Olfr1156 UTSW 2 87949547 missense probably benign 0.12
R1422:Olfr1156 UTSW 2 87950095 missense probably benign 0.00
R1958:Olfr1156 UTSW 2 87949465 missense probably damaging 1.00
R2239:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R2380:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R3872:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3873:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3874:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R4526:Olfr1156 UTSW 2 87949409 missense probably benign 0.09
R5116:Olfr1156 UTSW 2 87949529 missense probably benign 0.03
R5985:Olfr1156 UTSW 2 87949321 missense probably benign 0.02
R5999:Olfr1156 UTSW 2 87949801 splice site probably null
R6127:Olfr1156 UTSW 2 87949361 missense probably damaging 1.00
R6259:Olfr1156 UTSW 2 87949435 missense probably benign 0.20
R6544:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6556:Olfr1156 UTSW 2 87949976 missense probably benign 0.00
R6715:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6951:Olfr1156 UTSW 2 87949979 missense possibly damaging 0.79
R7062:Olfr1156 UTSW 2 87950224 missense probably benign 0.01
R7142:Olfr1156 UTSW 2 87949712 missense probably benign 0.09
R7749:Olfr1156 UTSW 2 87949478 missense probably damaging 1.00
R7887:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
R8222:Olfr1156 UTSW 2 87949444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGATCTCAAGGGCCAAGCACAG -3'
(R):5'- ATGTCCCAGAGCTGGCAATCTTTC -3'

Sequencing Primer
(F):5'- GGTGAATTAGAGAACACACTGATGC -3'
(R):5'- AACCTGGGCATGACTGTACTG -3'
Posted On2013-11-08