Incidental Mutation 'R0926:Frmpd1'
ID83190
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission 039073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0926 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45268497 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 214 (L214R)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably damaging
Transcript: ENSMUST00000044773
AA Change: L214R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: L214R

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107804
AA Change: L214R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: L214R

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Meta Mutation Damage Score 0.5752 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,549 D514G probably damaging Het
Acbd7 A T 2: 3,340,441 I41F possibly damaging Het
Actr8 G T 14: 29,987,224 V262L probably benign Het
Anp32e A G 3: 95,937,142 D108G probably damaging Het
Banp G A 8: 122,020,555 G448S probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Cd22 C A 7: 30,869,509 probably null Het
Cfap58 A T 19: 47,962,562 Q454L probably damaging Het
Cntn4 C T 6: 106,655,581 T522I probably benign Het
Col11a1 G A 3: 114,090,180 D233N unknown Het
Csmd1 G T 8: 16,033,576 probably null Het
Csmd3 T A 15: 47,977,033 Y946F probably damaging Het
D5Ertd579e G T 5: 36,672,866 P38Q probably damaging Het
Dnal4 T C 15: 79,762,025 T93A probably benign Het
Dsp A T 13: 38,183,218 D614V probably damaging Het
Fam160b1 G A 19: 57,381,090 A383T probably damaging Het
Fcgr1 A T 3: 96,292,366 I75N possibly damaging Het
Fgd6 T A 10: 94,135,047 Y1229N probably benign Het
Gapvd1 A T 2: 34,712,325 D603E probably damaging Het
H2-M9 A G 17: 36,641,773 V127A probably damaging Het
Herc2 T A 7: 56,132,548 S1328T possibly damaging Het
Ica1l T C 1: 60,006,297 N269S probably benign Het
Il18r1 T C 1: 40,487,028 Y245H probably damaging Het
Il6ra A T 3: 89,887,069 V195E probably damaging Het
Inpp5j A G 11: 3,501,439 probably benign Het
Isy1 T C 6: 87,819,143 T271A probably benign Het
Klra9 T C 6: 130,179,030 Y254C probably damaging Het
Ly6e T G 15: 74,958,370 S73A probably damaging Het
Mcmdc2 T A 1: 9,920,576 L326* probably null Het
Muc4 G A 16: 32,756,196 probably benign Het
Myh3 A G 11: 67,090,514 probably null Het
Ndor1 G A 2: 25,248,348 H409Y probably benign Het
Nwd2 A G 5: 63,807,891 D1606G probably damaging Het
Olfr1156 A T 2: 87,949,922 F104I probably damaging Het
Olfr1303 A G 2: 111,814,547 Y60H probably damaging Het
Olfr1451 A T 19: 12,999,190 D68V probably damaging Het
Olfr186 A G 16: 59,027,688 I73T possibly damaging Het
Olfr314 A G 11: 58,787,109 N292D probably damaging Het
Olfr411 G A 11: 74,347,306 R93C probably benign Het
Olfr585 T C 7: 103,097,885 L48P probably damaging Het
Paox C A 7: 140,134,038 T237K probably damaging Het
Pcmtd1 T A 1: 7,161,019 L4I probably damaging Het
Pfkl T A 10: 78,000,689 T165S probably damaging Het
Pik3ap1 A G 19: 41,302,525 S523P probably benign Het
Pitpnm1 A G 19: 4,112,338 D1056G probably damaging Het
Pitpnm2 G A 5: 124,131,209 T450I probably benign Het
Pou2f3 T C 9: 43,146,901 D37G probably damaging Het
Prdm5 A G 6: 65,883,547 H221R probably damaging Het
Pwp1 T A 10: 85,876,514 I72N probably damaging Het
Rhou A G 8: 123,660,976 E149G probably damaging Het
She A G 3: 89,851,594 probably benign Het
Slc26a9 A C 1: 131,753,216 H121P probably benign Het
Spag17 A G 3: 100,072,116 D1431G probably benign Het
Trpm3 A T 19: 22,988,043 D1634V probably benign Het
Ttn A G 2: 76,797,227 probably benign Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Zcrb1 T C 15: 93,391,528 K51E probably damaging Het
Zfp110 C T 7: 12,849,881 Q819* probably null Het
Zfp616 A G 11: 74,085,818 N971S probably benign Het
Zfp827 A T 8: 79,118,192 T664S probably benign Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
R7610:Frmpd1 UTSW 4 45279098 missense probably damaging 1.00
R7719:Frmpd1 UTSW 4 45284841 missense possibly damaging 0.52
R7724:Frmpd1 UTSW 4 45229888 missense probably damaging 1.00
R7891:Frmpd1 UTSW 4 45284478 missense probably benign 0.06
R7974:Frmpd1 UTSW 4 45284478 missense probably benign 0.06
R8010:Frmpd1 UTSW 4 45284272 missense not run
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Z1177:Frmpd1 UTSW 4 45275272 missense not run
Predicted Primers PCR Primer
(F):5'- TATCCAGACACTGAGGCAGGAGAC -3'
(R):5'- TCATAGGAACAGATGCAAACCAGGC -3'

Sequencing Primer
(F):5'- GCAAGATAGATTGCTGCCCTG -3'
(R):5'- AACCAGGCCAGAGTCTTGC -3'
Posted On2013-11-08