Incidental Mutation 'R0926:Cd22'
ID83199
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene NameCD22 antigen
SynonymsLyb-8, Lyb8
MMRRC Submission 039073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0926 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30865402-30880342 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 30869509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289]
Predicted Effect probably null
Transcript: ENSMUST00000019248
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108125
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186154
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably null
Transcript: ENSMUST00000189718
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Predicted Effect probably null
Transcript: ENSMUST00000190617
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190646
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000214289
Meta Mutation Damage Score 0.9587 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,549 D514G probably damaging Het
Acbd7 A T 2: 3,340,441 I41F possibly damaging Het
Actr8 G T 14: 29,987,224 V262L probably benign Het
Anp32e A G 3: 95,937,142 D108G probably damaging Het
Banp G A 8: 122,020,555 G448S probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Cfap58 A T 19: 47,962,562 Q454L probably damaging Het
Cntn4 C T 6: 106,655,581 T522I probably benign Het
Col11a1 G A 3: 114,090,180 D233N unknown Het
Csmd1 G T 8: 16,033,576 probably null Het
Csmd3 T A 15: 47,977,033 Y946F probably damaging Het
D5Ertd579e G T 5: 36,672,866 P38Q probably damaging Het
Dnal4 T C 15: 79,762,025 T93A probably benign Het
Dsp A T 13: 38,183,218 D614V probably damaging Het
Fam160b1 G A 19: 57,381,090 A383T probably damaging Het
Fcgr1 A T 3: 96,292,366 I75N possibly damaging Het
Fgd6 T A 10: 94,135,047 Y1229N probably benign Het
Frmpd1 T G 4: 45,268,497 L214R probably damaging Het
Gapvd1 A T 2: 34,712,325 D603E probably damaging Het
H2-M9 A G 17: 36,641,773 V127A probably damaging Het
Herc2 T A 7: 56,132,548 S1328T possibly damaging Het
Ica1l T C 1: 60,006,297 N269S probably benign Het
Il18r1 T C 1: 40,487,028 Y245H probably damaging Het
Il6ra A T 3: 89,887,069 V195E probably damaging Het
Inpp5j A G 11: 3,501,439 probably benign Het
Isy1 T C 6: 87,819,143 T271A probably benign Het
Klra9 T C 6: 130,179,030 Y254C probably damaging Het
Ly6e T G 15: 74,958,370 S73A probably damaging Het
Mcmdc2 T A 1: 9,920,576 L326* probably null Het
Muc4 G A 16: 32,756,196 probably benign Het
Myh3 A G 11: 67,090,514 probably null Het
Ndor1 G A 2: 25,248,348 H409Y probably benign Het
Nwd2 A G 5: 63,807,891 D1606G probably damaging Het
Olfr1156 A T 2: 87,949,922 F104I probably damaging Het
Olfr1303 A G 2: 111,814,547 Y60H probably damaging Het
Olfr1451 A T 19: 12,999,190 D68V probably damaging Het
Olfr186 A G 16: 59,027,688 I73T possibly damaging Het
Olfr314 A G 11: 58,787,109 N292D probably damaging Het
Olfr411 G A 11: 74,347,306 R93C probably benign Het
Olfr585 T C 7: 103,097,885 L48P probably damaging Het
Paox C A 7: 140,134,038 T237K probably damaging Het
Pcmtd1 T A 1: 7,161,019 L4I probably damaging Het
Pfkl T A 10: 78,000,689 T165S probably damaging Het
Pik3ap1 A G 19: 41,302,525 S523P probably benign Het
Pitpnm1 A G 19: 4,112,338 D1056G probably damaging Het
Pitpnm2 G A 5: 124,131,209 T450I probably benign Het
Pou2f3 T C 9: 43,146,901 D37G probably damaging Het
Prdm5 A G 6: 65,883,547 H221R probably damaging Het
Pwp1 T A 10: 85,876,514 I72N probably damaging Het
Rhou A G 8: 123,660,976 E149G probably damaging Het
She A G 3: 89,851,594 probably benign Het
Slc26a9 A C 1: 131,753,216 H121P probably benign Het
Spag17 A G 3: 100,072,116 D1431G probably benign Het
Trpm3 A T 19: 22,988,043 D1634V probably benign Het
Ttn A G 2: 76,797,227 probably benign Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Zcrb1 T C 15: 93,391,528 K51E probably damaging Het
Zfp110 C T 7: 12,849,881 Q819* probably null Het
Zfp616 A G 11: 74,085,818 N971S probably benign Het
Zfp827 A T 8: 79,118,192 T664S probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
crullers UTSW 7 30869883 missense probably damaging 1.00
gansu UTSW 7 30870105 missense probably damaging 1.00
lacrima UTSW 7 30876153 missense probably damaging 1.00
Lluvia UTSW 7 30870487 missense possibly damaging 0.48
Mist UTSW 7 30866658 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense probably null
Yosemite UTSW 7 30869509 critical splice donor site probably null
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 synonymous probably null
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30878079 missense probably benign 0.03
R7083:Cd22 UTSW 7 30868048 missense probably damaging 0.99
R7225:Cd22 UTSW 7 30877634 missense not run
R7732:Cd22 UTSW 7 30870057 missense probably damaging 1.00
X0025:Cd22 UTSW 7 30873419 unclassified probably null
Z1176:Cd22 UTSW 7 30867963 missense probably benign 0.03
Z1176:Cd22 UTSW 7 30869530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATCAAGGGCGAGATTGGC -3'
(R):5'- AACCTCCAAGTGCTGTGTGAGTG -3'

Sequencing Primer
(F):5'- GGGCGAGATTGGCATGTAG -3'
(R):5'- CTGTGAGAGTGATGCCAATCC -3'
Posted On2013-11-08