Mutagenetix > Incidental Mutation

Incidental Mutation 'R0926:Olfr585'

83201

Institutional Source

Beutler Lab

Gene Symbol

Olfr585

Ensembl Gene

ENSMUSG00000078080

Gene Name

olfactory receptor 585

Synonyms

MOR14-4, GA_x6K02T2PBJ9-5809085-5810035

MMRRC Submission

039073-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R0926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103097720-103098749 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103097885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 48 (L48P)

Ref Sequence

ENSEMBL: ENSMUSP00000100476 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104881]

AlphaFold

E9PXW4

Predicted Effect

probably damaging
Transcript: ENSMUST00000104881
AA Change: L48P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000100476
Gene: ENSMUSG00000078080
AA Change: L48P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	40	318	1.3e-109	PFAM
Pfam:7TM_GPCR_Srsx	45	315	5.9e-6	PFAM
Pfam:7tm_1	50	300	7.9e-23	PFAM

Meta Mutation Damage Score

0.3479

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.2%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	T	C	9: 57,257,549	D514G	probably damaging	Het
Acbd7	A	T	2: 3,340,441	I41F	possibly damaging	Het
Actr8	G	T	14: 29,987,224	V262L	probably benign	Het
Anp32e	A	G	3: 95,937,142	D108G	probably damaging	Het
Banp	G	A	8: 122,020,555	G448S	probably benign	Het
Camsap3	G	A	8: 3,587,960		probably null	Het
Cd22	C	A	7: 30,869,509		probably null	Het
Cfap58	A	T	19: 47,962,562	Q454L	probably damaging	Het
Cntn4	C	T	6: 106,655,581	T522I	probably benign	Het
Col11a1	G	A	3: 114,090,180	D233N	unknown	Het
Csmd1	G	T	8: 16,033,576		probably null	Het
Csmd3	T	A	15: 47,977,033	Y946F	probably damaging	Het
D5Ertd579e	G	T	5: 36,672,866	P38Q	probably damaging	Het
Dnal4	T	C	15: 79,762,025	T93A	probably benign	Het
Dsp	A	T	13: 38,183,218	D614V	probably damaging	Het
Fam160b1	G	A	19: 57,381,090	A383T	probably damaging	Het
Fcgr1	A	T	3: 96,292,366	I75N	possibly damaging	Het
Fgd6	T	A	10: 94,135,047	Y1229N	probably benign	Het
Frmpd1	T	G	4: 45,268,497	L214R	probably damaging	Het
Gapvd1	A	T	2: 34,712,325	D603E	probably damaging	Het
H2-M9	A	G	17: 36,641,773	V127A	probably damaging	Het
Herc2	T	A	7: 56,132,548	S1328T	possibly damaging	Het
Ica1l	T	C	1: 60,006,297	N269S	probably benign	Het
Il18r1	T	C	1: 40,487,028	Y245H	probably damaging	Het
Il6ra	A	T	3: 89,887,069	V195E	probably damaging	Het
Inpp5j	A	G	11: 3,501,439		probably benign	Het
Isy1	T	C	6: 87,819,143	T271A	probably benign	Het
Klra9	T	C	6: 130,179,030	Y254C	probably damaging	Het
Ly6e	T	G	15: 74,958,370	S73A	probably damaging	Het
Mcmdc2	T	A	1: 9,920,576	L326*	probably null	Het
Muc4	G	A	16: 32,756,196		probably benign	Het
Myh3	A	G	11: 67,090,514		probably null	Het
Ndor1	G	A	2: 25,248,348	H409Y	probably benign	Het
Nwd2	A	G	5: 63,807,891	D1606G	probably damaging	Het
Olfr1156	A	T	2: 87,949,922	F104I	probably damaging	Het
Olfr1303	A	G	2: 111,814,547	Y60H	probably damaging	Het
Olfr1451	A	T	19: 12,999,190	D68V	probably damaging	Het
Olfr186	A	G	16: 59,027,688	I73T	possibly damaging	Het
Olfr314	A	G	11: 58,787,109	N292D	probably damaging	Het
Olfr411	G	A	11: 74,347,306	R93C	probably benign	Het
Paox	C	A	7: 140,134,038	T237K	probably damaging	Het
Pcmtd1	T	A	1: 7,161,019	L4I	probably damaging	Het
Pfkl	T	A	10: 78,000,689	T165S	probably damaging	Het
Pik3ap1	A	G	19: 41,302,525	S523P	probably benign	Het
Pitpnm1	A	G	19: 4,112,338	D1056G	probably damaging	Het
Pitpnm2	G	A	5: 124,131,209	T450I	probably benign	Het
Pou2f3	T	C	9: 43,146,901	D37G	probably damaging	Het
Prdm5	A	G	6: 65,883,547	H221R	probably damaging	Het
Pwp1	T	A	10: 85,876,514	I72N	probably damaging	Het
Rhou	A	G	8: 123,660,976	E149G	probably damaging	Het
She	A	G	3: 89,851,594		probably benign	Het
Slc26a9	A	C	1: 131,753,216	H121P	probably benign	Het
Spag17	A	G	3: 100,072,116	D1431G	probably benign	Het
Trpm3	A	T	19: 22,988,043	D1634V	probably benign	Het
Ttn	A	G	2: 76,797,227		probably benign	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het
Zcrb1	T	C	15: 93,391,528	K51E	probably damaging	Het
Zfp110	C	T	7: 12,849,881	Q819*	probably null	Het
Zfp616	A	G	11: 74,085,818	N971S	probably benign	Het
Zfp827	A	T	8: 79,118,192	T664S	probably benign	Het

Other mutations in Olfr585

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01022:Olfr585	APN	7	103097870	missense	probably damaging	1.00
IGL02866:Olfr585	APN	7	103098383	missense	probably damaging	0.99
FR4548:Olfr585	UTSW	7	103098309	nonsense	probably null
FR4976:Olfr585	UTSW	7	103098309	small insertion	probably benign
R0893:Olfr585	UTSW	7	103098434	missense	probably benign	0.01
R1486:Olfr585	UTSW	7	103098430	missense	probably damaging	1.00
R2031:Olfr585	UTSW	7	103098164	missense	probably damaging	0.98
R3852:Olfr585	UTSW	7	103098184	missense	probably damaging	0.97
R4849:Olfr585	UTSW	7	103098319	missense	possibly damaging	0.95
R5241:Olfr585	UTSW	7	103098317	missense	probably benign	0.36
R5668:Olfr585	UTSW	7	103097896	missense	probably benign	0.42
R5841:Olfr585	UTSW	7	103097954	missense	probably damaging	1.00
R6902:Olfr585	UTSW	7	103098355	missense	probably benign	0.12
R7943:Olfr585	UTSW	7	103097946	missense	probably damaging	0.98
R8265:Olfr585	UTSW	7	103098097	missense	probably benign	0.00
R8969:Olfr585	UTSW	7	103098044	missense	probably damaging	0.99
R9345:Olfr585	UTSW	7	103098506	missense	possibly damaging	0.93
R9376:Olfr585	UTSW	7	103097764	missense	probably benign	0.01
R9702:Olfr585	UTSW	7	103098136	missense	probably damaging	0.99
RF003:Olfr585	UTSW	7	103098305
RF003:Olfr585	UTSW	7	103098306	nonsense	probably null
RF004:Olfr585	UTSW	7	103098305
RF004:Olfr585	UTSW	7	103098308	small insertion	probably benign
RF004:Olfr585	UTSW	7	103098309	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTTCCAAGAACTGAGTCTCCCACAT -3'
(R):5'- TGATTTCATTTGCCTGAAACCACAGGA -3'

Sequencing Primer
(F):5'- TGAGTCTCCCACATTGAAAGG -3'
(R):5'- ATTCTCAAGGTGGTTGACATTG -3'

Posted On

2013-11-08