Mutagenetix > Incidental Mutation

Incidental Mutation 'R0926:Pou2f3'

83209

Institutional Source

Beutler Lab

Gene Symbol

Pou2f3

Ensembl Gene

ENSMUSG00000032015

Gene Name

POU domain, class 2, transcription factor 3

Synonyms

Otf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11

MMRRC Submission

039073-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43123939-43210369 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43146901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 37 (D37G)

Ref Sequence

ENSEMBL: ENSMUSP00000034513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034513
AA Change: D37G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: D37G

Domain	Start	End	E-Value	Type
low complexity region	107	122	N/A	INTRINSIC
low complexity region	150	162	N/A	INTRINSIC
POU	164	238	1.47e-53	SMART
low complexity region	239	256	N/A	INTRINSIC
HOX	262	324	8.39e-20	SMART
low complexity region	337	352	N/A	INTRINSIC
low complexity region	362	378	N/A	INTRINSIC
low complexity region	386	408	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176636
AA Change: D49G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: D49G

Domain	Start	End	E-Value	Type
low complexity region	119	134	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
POU	176	250	1.47e-53	SMART
low complexity region	251	268	N/A	INTRINSIC
HOX	274	336	8.39e-20	SMART
low complexity region	349	364	N/A	INTRINSIC
low complexity region	374	390	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213862

Meta Mutation Damage Score

0.1221

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 95.2%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	T	C	9: 57,257,549	D514G	probably damaging	Het
Acbd7	A	T	2: 3,340,441	I41F	possibly damaging	Het
Actr8	G	T	14: 29,987,224	V262L	probably benign	Het
Anp32e	A	G	3: 95,937,142	D108G	probably damaging	Het
Banp	G	A	8: 122,020,555	G448S	probably benign	Het
Camsap3	G	A	8: 3,587,960		probably null	Het
Cd22	C	A	7: 30,869,509		probably null	Het
Cfap58	A	T	19: 47,962,562	Q454L	probably damaging	Het
Cntn4	C	T	6: 106,655,581	T522I	probably benign	Het
Col11a1	G	A	3: 114,090,180	D233N	unknown	Het
Csmd1	G	T	8: 16,033,576		probably null	Het
Csmd3	T	A	15: 47,977,033	Y946F	probably damaging	Het
D5Ertd579e	G	T	5: 36,672,866	P38Q	probably damaging	Het
Dnal4	T	C	15: 79,762,025	T93A	probably benign	Het
Dsp	A	T	13: 38,183,218	D614V	probably damaging	Het
Fam160b1	G	A	19: 57,381,090	A383T	probably damaging	Het
Fcgr1	A	T	3: 96,292,366	I75N	possibly damaging	Het
Fgd6	T	A	10: 94,135,047	Y1229N	probably benign	Het
Frmpd1	T	G	4: 45,268,497	L214R	probably damaging	Het
Gapvd1	A	T	2: 34,712,325	D603E	probably damaging	Het
H2-M9	A	G	17: 36,641,773	V127A	probably damaging	Het
Herc2	T	A	7: 56,132,548	S1328T	possibly damaging	Het
Ica1l	T	C	1: 60,006,297	N269S	probably benign	Het
Il18r1	T	C	1: 40,487,028	Y245H	probably damaging	Het
Il6ra	A	T	3: 89,887,069	V195E	probably damaging	Het
Inpp5j	A	G	11: 3,501,439		probably benign	Het
Isy1	T	C	6: 87,819,143	T271A	probably benign	Het
Klra9	T	C	6: 130,179,030	Y254C	probably damaging	Het
Ly6e	T	G	15: 74,958,370	S73A	probably damaging	Het
Mcmdc2	T	A	1: 9,920,576	L326*	probably null	Het
Muc4	G	A	16: 32,756,196		probably benign	Het
Myh3	A	G	11: 67,090,514		probably null	Het
Ndor1	G	A	2: 25,248,348	H409Y	probably benign	Het
Nwd2	A	G	5: 63,807,891	D1606G	probably damaging	Het
Olfr1156	A	T	2: 87,949,922	F104I	probably damaging	Het
Olfr1303	A	G	2: 111,814,547	Y60H	probably damaging	Het
Olfr1451	A	T	19: 12,999,190	D68V	probably damaging	Het
Olfr186	A	G	16: 59,027,688	I73T	possibly damaging	Het
Olfr314	A	G	11: 58,787,109	N292D	probably damaging	Het
Olfr411	G	A	11: 74,347,306	R93C	probably benign	Het
Olfr585	T	C	7: 103,097,885	L48P	probably damaging	Het
Paox	C	A	7: 140,134,038	T237K	probably damaging	Het
Pcmtd1	T	A	1: 7,161,019	L4I	probably damaging	Het
Pfkl	T	A	10: 78,000,689	T165S	probably damaging	Het
Pik3ap1	A	G	19: 41,302,525	S523P	probably benign	Het
Pitpnm1	A	G	19: 4,112,338	D1056G	probably damaging	Het
Pitpnm2	G	A	5: 124,131,209	T450I	probably benign	Het
Prdm5	A	G	6: 65,883,547	H221R	probably damaging	Het
Pwp1	T	A	10: 85,876,514	I72N	probably damaging	Het
Rhou	A	G	8: 123,660,976	E149G	probably damaging	Het
She	A	G	3: 89,851,594		probably benign	Het
Slc26a9	A	C	1: 131,753,216	H121P	probably benign	Het
Spag17	A	G	3: 100,072,116	D1431G	probably benign	Het
Trpm3	A	T	19: 22,988,043	D1634V	probably benign	Het
Ttn	A	G	2: 76,797,227		probably benign	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het
Zcrb1	T	C	15: 93,391,528	K51E	probably damaging	Het
Zfp110	C	T	7: 12,849,881	Q819*	probably null	Het
Zfp616	A	G	11: 74,085,818	N971S	probably benign	Het
Zfp827	A	T	8: 79,118,192	T664S	probably benign	Het

Other mutations in Pou2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pou2f3	APN	9	43128893	missense	probably damaging	1.00
IGL00508:Pou2f3	APN	9	43139963	missense	probably benign	0.01
IGL00975:Pou2f3	APN	9	43137384	missense	probably benign
IGL01577:Pou2f3	APN	9	43146881	nonsense	probably null
IGL01871:Pou2f3	APN	9	43134473	splice site	probably benign
IGL02370:Pou2f3	APN	9	43137348	missense	probably damaging	1.00
IGL02674:Pou2f3	APN	9	43139333	missense	probably damaging	1.00
IGL02746:Pou2f3	APN	9	43146846	missense	probably benign	0.01
IGL02956:Pou2f3	APN	9	43142805	splice site	probably benign
IGL02962:Pou2f3	APN	9	43125089	utr 3 prime	probably benign
IGL03082:Pou2f3	APN	9	43146915	critical splice acceptor site	probably null
R0433:Pou2f3	UTSW	9	43127398	missense	probably benign	0.23
R0622:Pou2f3	UTSW	9	43125119	missense	probably damaging	1.00
R1956:Pou2f3	UTSW	9	43145237	missense	probably benign
R4782:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R4877:Pou2f3	UTSW	9	43139323	missense	possibly damaging	0.58
R5070:Pou2f3	UTSW	9	43145281	missense	possibly damaging	0.52
R5910:Pou2f3	UTSW	9	43134474	splice site	probably null
R6280:Pou2f3	UTSW	9	43139339	missense	probably damaging	1.00
R6280:Pou2f3	UTSW	9	43139340	missense	probably damaging	1.00
R6465:Pou2f3	UTSW	9	43139867	missense	probably damaging	1.00
R7084:Pou2f3	UTSW	9	43128893	missense	probably damaging	1.00
R7161:Pou2f3	UTSW	9	43139363	missense	probably damaging	1.00
R8036:Pou2f3	UTSW	9	43146908	missense	probably damaging	1.00
R8406:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R8912:Pou2f3	UTSW	9	43199039	missense	probably benign	0.00
R9224:Pou2f3	UTSW	9	43139399	missense	probably damaging	1.00
R9329:Pou2f3	UTSW	9	43128929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATTCACAACGTGTGCCAAGAAG -3'
(R):5'- CTAGCACAGCCCAAGAAGGGTG -3'

Sequencing Primer
(F):5'- GAGAAGCCCAGCATTTTGTAG -3'
(R):5'- CCCAAGAAGGGTGTTGGTG -3'

Posted On

2013-11-08