Incidental Mutation 'R0904:Bpifb9a'
ID 83236
Institutional Source Beutler Lab
Gene Symbol Bpifb9a
Ensembl Gene ENSMUSG00000067998
Gene Name BPI fold containing family B, member 9A
Synonyms 4833413D08Rik, vomeromodulin
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 154257854-154271245 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 154264225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088924]
AlphaFold Q80XI7
Predicted Effect probably benign
Transcript: ENSMUST00000088924
SMART Domains Protein: ENSMUSP00000086314
Gene: ENSMUSG00000067998

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147299
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Bpifb9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Bpifb9a APN 2 154264275 nonsense probably null
IGL00899:Bpifb9a APN 2 154264727 splice site probably null
IGL01998:Bpifb9a APN 2 154268200 critical splice donor site probably null
IGL02158:Bpifb9a APN 2 154266813 splice site probably benign
IGL02331:Bpifb9a APN 2 154262387 missense possibly damaging 0.45
R0066:Bpifb9a UTSW 2 154266841 missense possibly damaging 0.95
R0480:Bpifb9a UTSW 2 154264688 missense probably benign 0.33
R0545:Bpifb9a UTSW 2 154261950 nonsense probably null
R1028:Bpifb9a UTSW 2 154262407 missense possibly damaging 0.45
R1158:Bpifb9a UTSW 2 154262264 missense probably benign 0.08
R1465:Bpifb9a UTSW 2 154271021 missense possibly damaging 0.85
R1465:Bpifb9a UTSW 2 154271021 missense possibly damaging 0.85
R1902:Bpifb9a UTSW 2 154261991 missense probably benign 0.00
R2015:Bpifb9a UTSW 2 154268200 critical splice donor site probably null
R2152:Bpifb9a UTSW 2 154260135 missense probably benign 0.28
R2206:Bpifb9a UTSW 2 154264241 splice site probably null
R5410:Bpifb9a UTSW 2 154270235 missense probably benign 0.05
R5731:Bpifb9a UTSW 2 154262243 missense possibly damaging 0.87
R5818:Bpifb9a UTSW 2 154262295 missense probably damaging 0.98
R5865:Bpifb9a UTSW 2 154266836 missense probably benign 0.26
R6564:Bpifb9a UTSW 2 154260178 missense probably benign 0.00
R7291:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7294:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7295:Bpifb9a UTSW 2 154267696 missense probably damaging 1.00
R7453:Bpifb9a UTSW 2 154264695 missense probably damaging 0.99
R7570:Bpifb9a UTSW 2 154262263 missense possibly damaging 0.46
R8187:Bpifb9a UTSW 2 154269457 missense probably benign 0.00
R8245:Bpifb9a UTSW 2 154262726 missense probably benign 0.00
R8459:Bpifb9a UTSW 2 154260233 missense probably damaging 0.98
R8481:Bpifb9a UTSW 2 154269479 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGTTCCCATGTCCTGTCCAAAGC -3'
(R):5'- GGCCACTTATAACCTGCAAGCGTTC -3'

Sequencing Primer
(F):5'- TTCCACTGTCTGAAGGATGAAGC -3'
(R):5'- ATAACCTGCAAGCGTTCTCTCC -3'
Posted On 2013-11-08