Incidental Mutation 'R0904:Bpifb9a'
ID 83236
Institutional Source Beutler Lab
Gene Symbol Bpifb9a
Ensembl Gene ENSMUSG00000067998
Gene Name BPI fold containing family B, member 9A
Synonyms 4833413D08Rik, vomeromodulin
MMRRC Submission 039062-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 154099799-154113165 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 154106145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088924]
AlphaFold Q80XI7
Predicted Effect probably benign
Transcript: ENSMUST00000088924
SMART Domains Protein: ENSMUSP00000086314
Gene: ENSMUSG00000067998

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147299
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,975,118 (GRCm39) probably benign Het
Abca13 T C 11: 9,248,740 (GRCm39) V2829A probably benign Het
Adk G T 14: 21,142,496 (GRCm39) D26Y probably damaging Het
Dap G A 15: 31,272,526 (GRCm39) probably benign Het
Eqtn A T 4: 94,795,892 (GRCm39) S270T probably benign Het
Fam193a A G 5: 34,619,487 (GRCm39) D764G probably damaging Het
Fbxl6 A T 15: 76,421,283 (GRCm39) probably null Het
Gtf3c1 A T 7: 125,268,014 (GRCm39) probably benign Het
H2-D1 G C 17: 35,482,837 (GRCm39) M122I probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Map1s C A 8: 71,366,832 (GRCm39) P579Q probably damaging Het
Mapk10 A G 5: 103,135,146 (GRCm39) probably benign Het
Mllt6 C G 11: 97,555,824 (GRCm39) C51W probably damaging Het
Mzf1 C A 7: 12,786,698 (GRCm39) R124L possibly damaging Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Neurod2 G T 11: 98,218,147 (GRCm39) T339K probably benign Het
Nfya G A 17: 48,702,815 (GRCm39) Q29* probably null Het
Nipbl A T 15: 8,391,202 (GRCm39) D257E probably benign Het
Pate5 T C 9: 35,750,366 (GRCm39) D102G probably damaging Het
Pex5 G A 6: 124,376,896 (GRCm39) probably benign Het
Pramel47 A C 5: 95,489,186 (GRCm39) T210P probably damaging Het
Prx T A 7: 27,217,719 (GRCm39) F879Y probably damaging Het
Resf1 G A 6: 149,229,767 (GRCm39) A938T probably damaging Het
Scai G A 2: 38,965,164 (GRCm39) T560M possibly damaging Het
Slfn10-ps T C 11: 82,926,235 (GRCm39) noncoding transcript Het
Spdye4b A G 5: 143,181,423 (GRCm39) probably benign Het
Ss18l1 A G 2: 179,701,147 (GRCm39) Y287C probably damaging Het
Tpbg C A 9: 85,726,617 (GRCm39) F195L unknown Het
Trbv16 T C 6: 41,128,781 (GRCm39) probably benign Het
Unc5c A G 3: 141,509,601 (GRCm39) T620A probably benign Het
Vangl1 A G 3: 102,091,310 (GRCm39) S259P probably damaging Het
Vmn1r52 T A 6: 90,156,446 (GRCm39) M71K probably damaging Het
Vmn2r23 A T 6: 123,719,094 (GRCm39) I816F probably damaging Het
Zfp268 T C 4: 145,348,745 (GRCm39) Y61H possibly damaging Het
Other mutations in Bpifb9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Bpifb9a APN 2 154,106,195 (GRCm39) nonsense probably null
IGL00899:Bpifb9a APN 2 154,106,647 (GRCm39) splice site probably null
IGL01998:Bpifb9a APN 2 154,110,120 (GRCm39) critical splice donor site probably null
IGL02158:Bpifb9a APN 2 154,108,733 (GRCm39) splice site probably benign
IGL02331:Bpifb9a APN 2 154,104,307 (GRCm39) missense possibly damaging 0.45
R0066:Bpifb9a UTSW 2 154,108,761 (GRCm39) missense possibly damaging 0.95
R0480:Bpifb9a UTSW 2 154,106,608 (GRCm39) missense probably benign 0.33
R0545:Bpifb9a UTSW 2 154,103,870 (GRCm39) nonsense probably null
R1028:Bpifb9a UTSW 2 154,104,327 (GRCm39) missense possibly damaging 0.45
R1158:Bpifb9a UTSW 2 154,104,184 (GRCm39) missense probably benign 0.08
R1465:Bpifb9a UTSW 2 154,112,941 (GRCm39) missense possibly damaging 0.85
R1465:Bpifb9a UTSW 2 154,112,941 (GRCm39) missense possibly damaging 0.85
R1902:Bpifb9a UTSW 2 154,103,911 (GRCm39) missense probably benign 0.00
R2015:Bpifb9a UTSW 2 154,110,120 (GRCm39) critical splice donor site probably null
R2152:Bpifb9a UTSW 2 154,102,055 (GRCm39) missense probably benign 0.28
R2206:Bpifb9a UTSW 2 154,106,161 (GRCm39) splice site probably null
R5410:Bpifb9a UTSW 2 154,112,155 (GRCm39) missense probably benign 0.05
R5731:Bpifb9a UTSW 2 154,104,163 (GRCm39) missense possibly damaging 0.87
R5818:Bpifb9a UTSW 2 154,104,215 (GRCm39) missense probably damaging 0.98
R5865:Bpifb9a UTSW 2 154,108,756 (GRCm39) missense probably benign 0.26
R6564:Bpifb9a UTSW 2 154,102,098 (GRCm39) missense probably benign 0.00
R7291:Bpifb9a UTSW 2 154,109,616 (GRCm39) missense probably damaging 1.00
R7294:Bpifb9a UTSW 2 154,109,616 (GRCm39) missense probably damaging 1.00
R7295:Bpifb9a UTSW 2 154,109,616 (GRCm39) missense probably damaging 1.00
R7453:Bpifb9a UTSW 2 154,106,615 (GRCm39) missense probably damaging 0.99
R7570:Bpifb9a UTSW 2 154,104,183 (GRCm39) missense possibly damaging 0.46
R8187:Bpifb9a UTSW 2 154,111,377 (GRCm39) missense probably benign 0.00
R8245:Bpifb9a UTSW 2 154,104,646 (GRCm39) missense probably benign 0.00
R8459:Bpifb9a UTSW 2 154,102,153 (GRCm39) missense probably damaging 0.98
R8481:Bpifb9a UTSW 2 154,111,399 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGTTCCCATGTCCTGTCCAAAGC -3'
(R):5'- GGCCACTTATAACCTGCAAGCGTTC -3'

Sequencing Primer
(F):5'- TTCCACTGTCTGAAGGATGAAGC -3'
(R):5'- ATAACCTGCAAGCGTTCTCTCC -3'
Posted On 2013-11-08