Mutagenetix > Incidental Mutation

Incidental Mutation 'R0904:Bpifb9a'

83236

Institutional Source

Beutler Lab

Gene Symbol

Bpifb9a

Ensembl Gene

ENSMUSG00000067998

Gene Name

BPI fold containing family B, member 9A

Synonyms

4833413D08Rik, vomeromodulin

MMRRC Submission

039062-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154257854-154271245 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 154264225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000086314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088924]

AlphaFold

Q80XI7

Predicted Effect

probably benign
Transcript: ENSMUST00000088924

SMART Domains

Protein: ENSMUSP00000086314
Gene: ENSMUSG00000067998

Domain	Start	End	E-Value	Type
low complexity region	60	77	N/A	INTRINSIC
low complexity region	122	157	N/A	INTRINSIC
low complexity region	167	181	N/A	INTRINSIC
low complexity region	184	203	N/A	INTRINSIC
Pfam:LBP_BPI_CETP	216	377	1.1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126084

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147299

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.2%
20x: 94.7%

Validation Efficiency

89% (34/38)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	G	8: 79,248,489		probably benign	Het
2810474O19Rik	G	A	6: 149,328,269	A938T	probably damaging	Het
9230110F15Rik	T	C	9: 35,839,070	D102G	probably damaging	Het
Abca13	T	C	11: 9,298,740	V2829A	probably benign	Het
Adk	G	T	14: 21,092,428	D26Y	probably damaging	Het
Dap	G	A	15: 31,272,380		probably benign	Het
Eqtn	A	T	4: 94,907,655	S270T	probably benign	Het
Fam193a	A	G	5: 34,462,143	D764G	probably damaging	Het
Fbxl6	A	T	15: 76,537,083		probably null	Het
Gm13212	T	C	4: 145,622,175	Y61H	possibly damaging	Het
Gm3259	A	C	5: 95,341,327	T210P	probably damaging	Het
Gtf3c1	A	T	7: 125,668,842		probably benign	Het
H2-D1	G	C	17: 35,263,861	M122I	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map1s	C	A	8: 70,914,188	P579Q	probably damaging	Het
Mapk10	A	G	5: 102,987,280		probably benign	Het
Mllt6	C	G	11: 97,664,998	C51W	probably damaging	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Neurod2	G	T	11: 98,327,321	T339K	probably benign	Het
Nfya	G	A	17: 48,395,787	Q29*	probably null	Het
Nipbl	A	T	15: 8,361,718	D257E	probably benign	Het
Pex5	G	A	6: 124,399,937		probably benign	Het
Prx	T	A	7: 27,518,294	F879Y	probably damaging	Het
Scai	G	A	2: 39,075,152	T560M	possibly damaging	Het
Slfn10-ps	T	C	11: 83,035,409		noncoding transcript	Het
Spdye4b	A	G	5: 143,195,668		probably benign	Het
Ss18l1	A	G	2: 180,059,354	Y287C	probably damaging	Het
Tpbg	C	A	9: 85,844,564	F195L	unknown	Het
Trbv16	T	C	6: 41,151,847		probably benign	Het
Unc5c	A	G	3: 141,803,840	T620A	probably benign	Het
Vangl1	A	G	3: 102,183,994	S259P	probably damaging	Het
Vmn1r52	T	A	6: 90,179,464	M71K	probably damaging	Het
Vmn2r23	A	T	6: 123,742,135	I816F	probably damaging	Het

Other mutations in Bpifb9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Bpifb9a	APN	2	154264275	nonsense	probably null
IGL00899:Bpifb9a	APN	2	154264727	splice site	probably null
IGL01998:Bpifb9a	APN	2	154268200	critical splice donor site	probably null
IGL02158:Bpifb9a	APN	2	154266813	splice site	probably benign
IGL02331:Bpifb9a	APN	2	154262387	missense	possibly damaging	0.45
R0066:Bpifb9a	UTSW	2	154266841	missense	possibly damaging	0.95
R0480:Bpifb9a	UTSW	2	154264688	missense	probably benign	0.33
R0545:Bpifb9a	UTSW	2	154261950	nonsense	probably null
R1028:Bpifb9a	UTSW	2	154262407	missense	possibly damaging	0.45
R1158:Bpifb9a	UTSW	2	154262264	missense	probably benign	0.08
R1465:Bpifb9a	UTSW	2	154271021	missense	possibly damaging	0.85
R1465:Bpifb9a	UTSW	2	154271021	missense	possibly damaging	0.85
R1902:Bpifb9a	UTSW	2	154261991	missense	probably benign	0.00
R2015:Bpifb9a	UTSW	2	154268200	critical splice donor site	probably null
R2152:Bpifb9a	UTSW	2	154260135	missense	probably benign	0.28
R2206:Bpifb9a	UTSW	2	154264241	splice site	probably null
R5410:Bpifb9a	UTSW	2	154270235	missense	probably benign	0.05
R5731:Bpifb9a	UTSW	2	154262243	missense	possibly damaging	0.87
R5818:Bpifb9a	UTSW	2	154262295	missense	probably damaging	0.98
R5865:Bpifb9a	UTSW	2	154266836	missense	probably benign	0.26
R6564:Bpifb9a	UTSW	2	154260178	missense	probably benign	0.00
R7291:Bpifb9a	UTSW	2	154267696	missense	probably damaging	1.00
R7294:Bpifb9a	UTSW	2	154267696	missense	probably damaging	1.00
R7295:Bpifb9a	UTSW	2	154267696	missense	probably damaging	1.00
R7453:Bpifb9a	UTSW	2	154264695	missense	probably damaging	0.99
R7570:Bpifb9a	UTSW	2	154262263	missense	possibly damaging	0.46
R8187:Bpifb9a	UTSW	2	154269457	missense	probably benign	0.00
R8245:Bpifb9a	UTSW	2	154262726	missense	probably benign	0.00
R8459:Bpifb9a	UTSW	2	154260233	missense	probably damaging	0.98
R8481:Bpifb9a	UTSW	2	154269479	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTAGTTCCCATGTCCTGTCCAAAGC -3'
(R):5'- GGCCACTTATAACCTGCAAGCGTTC -3'

Sequencing Primer
(F):5'- TTCCACTGTCTGAAGGATGAAGC -3'
(R):5'- ATAACCTGCAAGCGTTCTCTCC -3'

Posted On

2013-11-08