Mutagenetix > Incidental Mutations

Incidental Mutation 'R0904:Vangl1'

83238

Institutional Source

Beutler Lab

Gene Symbol

Vangl1

Ensembl Gene

ENSMUSG00000027860

Gene Name

VANGL planar cell polarity 1

Synonyms

mStbm, stbm, Lpp2, KITENIN

MMRRC Submission

039062-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R0904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102153583-102204693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102183994 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 259 (S259P)

Ref Sequence

ENSEMBL: ENSMUSP00000125043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000159586] [ENSMUST00000168312]

AlphaFold

Q80Z96

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029453
AA Change: S259P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: S259P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	23	360	3.4e-171	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159388
AA Change: S259P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860
AA Change: S259P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	25	526	8.6e-262	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159586

SMART Domains

Protein: ENSMUSP00000124874
Gene: ENSMUSG00000027860

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	23	137	3.5e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168312
AA Change: S259P

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860
AA Change: S259P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Pfam:Strabismus	23	357	1.2e-170	PFAM
Pfam:Strabismus	354	476	9.5e-67	PFAM

Meta Mutation Damage Score

0.8497

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.2%
20x: 94.7%

Validation Efficiency

89% (34/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	G	8: 79,248,489		probably benign	Het
2810474O19Rik	G	A	6: 149,328,269	A938T	probably damaging	Het
9230110F15Rik	T	C	9: 35,839,070	D102G	probably damaging	Het
Abca13	T	C	11: 9,298,740	V2829A	probably benign	Het
Adk	G	T	14: 21,092,428	D26Y	probably damaging	Het
Bpifb9a	T	C	2: 154,264,225		probably benign	Het
Dap	G	A	15: 31,272,380		probably benign	Het
Eqtn	A	T	4: 94,907,655	S270T	probably benign	Het
Fam193a	A	G	5: 34,462,143	D764G	probably damaging	Het
Fbxl6	A	T	15: 76,537,083		probably null	Het
Gm13212	T	C	4: 145,622,175	Y61H	possibly damaging	Het
Gm3259	A	C	5: 95,341,327	T210P	probably damaging	Het
Gtf3c1	A	T	7: 125,668,842		probably benign	Het
H2-D1	G	C	17: 35,263,861	M122I	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map1s	C	A	8: 70,914,188	P579Q	probably damaging	Het
Mapk10	A	G	5: 102,987,280		probably benign	Het
Mllt6	C	G	11: 97,664,998	C51W	probably damaging	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Neurod2	G	T	11: 98,327,321	T339K	probably benign	Het
Nfya	G	A	17: 48,395,787	Q29*	probably null	Het
Nipbl	A	T	15: 8,361,718	D257E	probably benign	Het
Pex5	G	A	6: 124,399,937		probably benign	Het
Prx	T	A	7: 27,518,294	F879Y	probably damaging	Het
Scai	G	A	2: 39,075,152	T560M	possibly damaging	Het
Slfn10-ps	T	C	11: 83,035,409		noncoding transcript	Het
Spdye4b	A	G	5: 143,195,668		probably benign	Het
Ss18l1	A	G	2: 180,059,354	Y287C	probably damaging	Het
Tpbg	C	A	9: 85,844,564	F195L	unknown	Het
Trbv16	T	C	6: 41,151,847		probably benign	Het
Unc5c	A	G	3: 141,803,840	T620A	probably benign	Het
Vmn1r52	T	A	6: 90,179,464	M71K	probably damaging	Het
Vmn2r23	A	T	6: 123,742,135	I816F	probably damaging	Het

Other mutations in Vangl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Vangl1	APN	3	102158229	utr 3 prime	probably benign
IGL00870:Vangl1	APN	3	102189440	missense	probably damaging	1.00
IGL01533:Vangl1	APN	3	102163351	missense	possibly damaging	0.88
IGL01981:Vangl1	APN	3	102184291	missense	probably damaging	1.00
IGL02792:Vangl1	APN	3	102163423	missense	probably damaging	0.98
IGL02800:Vangl1	APN	3	102163295	splice site	probably benign
IGL02942:Vangl1	APN	3	102184031	missense	probably damaging	1.00
IGL03029:Vangl1	APN	3	102184084	missense	probably damaging	1.00
R0600:Vangl1	UTSW	3	102166937	missense	probably damaging	1.00
R1230:Vangl1	UTSW	3	102158293	missense	probably benign	0.00
R1829:Vangl1	UTSW	3	102163466	missense	probably benign
R2005:Vangl1	UTSW	3	102163466	missense	probably benign
R2268:Vangl1	UTSW	3	102196844	missense	probably damaging	1.00
R4181:Vangl1	UTSW	3	102165781	intron	probably benign
R4662:Vangl1	UTSW	3	102166922	missense	probably benign	0.00
R4724:Vangl1	UTSW	3	102184554	missense	probably damaging	1.00
R4755:Vangl1	UTSW	3	102158292	missense	probably benign	0.19
R5548:Vangl1	UTSW	3	102184446	missense	possibly damaging	0.76
R5740:Vangl1	UTSW	3	102184134	missense	probably damaging	0.99
R5758:Vangl1	UTSW	3	102184092	missense	probably damaging	1.00
R6150:Vangl1	UTSW	3	102184519	missense	probably damaging	1.00
R6373:Vangl1	UTSW	3	102158448	missense	probably benign
R6943:Vangl1	UTSW	3	102165781	intron	probably benign
R7474:Vangl1	UTSW	3	102184249	missense	probably benign	0.22
R7616:Vangl1	UTSW	3	102184065	missense	probably damaging	1.00
R8120:Vangl1	UTSW	3	102163442	nonsense	probably null
R8827:Vangl1	UTSW	3	102163420	missense	probably damaging	0.99
R8859:Vangl1	UTSW	3	102158442	missense

Predicted Primers

PCR Primer
(F):5'- TGCCATTGAGGTAGAGTGTGAGTCC -3'
(R):5'- CACTTTTCTTCCGCAAGCAAAGAGC -3'

Sequencing Primer
(F):5'- TGTGAGTCCAGTAAAACCCTG -3'
(R):5'- GCGCTGTTACTGGTCCTTATC -3'

Posted On

2013-11-08