Incidental Mutation 'R0904:Eqtn'
ID 83240
Institutional Source Beutler Lab
Gene Symbol Eqtn
Ensembl Gene ENSMUSG00000028575
Gene Name equatorin, sperm acrosome associated
Synonyms 4930579C15Rik, 1700028B15Rik, Afaf, equatorin
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 94907267-94928843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94907655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 270 (S270T)
Ref Sequence ENSEMBL: ENSMUSP00000030309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030309] [ENSMUST00000107097]
AlphaFold Q9D9V2
Predicted Effect probably benign
Transcript: ENSMUST00000030309
AA Change: S270T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030309
Gene: ENSMUSG00000028575
AA Change: S270T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Afaf 64 252 1.2e-95 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107097
SMART Domains Protein: ENSMUSP00000102714
Gene: ENSMUSG00000028575

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Afaf 64 250 1.1e-86 PFAM
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Eqtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0088:Eqtn UTSW 4 94919990 missense probably damaging 0.99
R1605:Eqtn UTSW 4 94928350 missense possibly damaging 0.83
R2290:Eqtn UTSW 4 94926942 small deletion probably benign
R4072:Eqtn UTSW 4 94919962 missense possibly damaging 0.91
R4073:Eqtn UTSW 4 94919962 missense possibly damaging 0.91
R4074:Eqtn UTSW 4 94919962 missense possibly damaging 0.91
R4075:Eqtn UTSW 4 94919962 missense possibly damaging 0.91
R5379:Eqtn UTSW 4 94907588 missense probably damaging 1.00
R5485:Eqtn UTSW 4 94924956 missense possibly damaging 0.93
R5691:Eqtn UTSW 4 94923728 critical splice acceptor site probably null
R6252:Eqtn UTSW 4 94907769 missense probably damaging 0.98
R6707:Eqtn UTSW 4 94907819 missense probably benign 0.01
R6873:Eqtn UTSW 4 94927021 missense probably damaging 0.99
R7209:Eqtn UTSW 4 94925569 missense probably damaging 1.00
R7235:Eqtn UTSW 4 94923699 missense probably damaging 0.98
R7651:Eqtn UTSW 4 94923707 missense possibly damaging 0.52
R7652:Eqtn UTSW 4 94928337 missense probably damaging 1.00
X0063:Eqtn UTSW 4 94928318 critical splice donor site probably null
Z1177:Eqtn UTSW 4 94907551 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGCATCAATCTCATTCATTGCCTGCAT -3'
(R):5'- GGCTGCATACACCAGATATTGCTAGTT -3'

Sequencing Primer
(F):5'- ATAGGGCCTCTCTCAACGATG -3'
(R):5'- CAACTAAAGACTACTCTTGGTGTGTG -3'
Posted On 2013-11-08