Incidental Mutation 'R0904:Gm13212'
ID 83241
Institutional Source Beutler Lab
Gene Symbol Gm13212
Ensembl Gene ENSMUSG00000078502
Gene Name predicted gene 13212
Synonyms
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R0904 (G1)
Quality Score 207
Status Validated
Chromosome 4
Chromosomal Location 145585166-145625345 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 145622175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 61 (Y61H)
Ref Sequence ENSEMBL: ENSMUSP00000112918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097794] [ENSMUST00000105739] [ENSMUST00000119718]
AlphaFold B1ASQ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000097794
AA Change: Y61H

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095402
Gene: ENSMUSG00000078502
AA Change: Y61H

DomainStartEndE-ValueType
KRAB 13 72 3.23e-18 SMART
ZnF_C2H2 238 260 1.69e-3 SMART
ZnF_C2H2 266 288 1.18e-2 SMART
ZnF_C2H2 294 316 1.3e-4 SMART
ZnF_C2H2 322 344 1.58e-3 SMART
ZnF_C2H2 350 372 4.24e-4 SMART
ZnF_C2H2 378 400 1.06e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105739
AA Change: Y61H

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101365
Gene: ENSMUSG00000078502
AA Change: Y61H

DomainStartEndE-ValueType
KRAB 13 72 3.23e-18 SMART
ZnF_C2H2 238 260 1.69e-3 SMART
ZnF_C2H2 266 288 1.18e-2 SMART
ZnF_C2H2 294 316 1.3e-4 SMART
ZnF_C2H2 322 344 1.58e-3 SMART
ZnF_C2H2 350 372 4.24e-4 SMART
ZnF_C2H2 378 400 1.06e-4 SMART
ZnF_C2H2 406 428 1.58e-3 SMART
ZnF_C2H2 434 456 3.39e-3 SMART
ZnF_C2H2 462 484 1.06e-4 SMART
ZnF_C2H2 490 512 1.58e-3 SMART
ZnF_C2H2 518 540 3.39e-3 SMART
ZnF_C2H2 546 568 3.39e-3 SMART
ZnF_C2H2 574 596 3.39e-3 SMART
ZnF_C2H2 602 624 3.39e-3 SMART
ZnF_C2H2 630 652 1.06e-4 SMART
ZnF_C2H2 658 680 1.58e-3 SMART
ZnF_C2H2 686 708 3.39e-3 SMART
ZnF_C2H2 714 736 1.3e-4 SMART
ZnF_C2H2 742 764 1.3e-4 SMART
ZnF_C2H2 770 792 4.79e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119718
AA Change: Y61H

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112918
Gene: ENSMUSG00000078502
AA Change: Y61H

DomainStartEndE-ValueType
KRAB 13 72 3.23e-18 SMART
internal_repeat_1 141 211 2.19e-13 PROSPERO
ZnF_C2H2 238 260 1.69e-3 SMART
ZnF_C2H2 266 288 1.18e-2 SMART
low complexity region 320 335 N/A INTRINSIC
low complexity region 350 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180968
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Gm13212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Gm13212 APN 4 145620671 missense probably damaging 0.98
IGL02678:Gm13212 APN 4 145622497 missense probably damaging 1.00
IGL03035:Gm13212 APN 4 145622232 missense possibly damaging 0.77
BB008:Gm13212 UTSW 4 145622556 missense possibly damaging 0.49
BB018:Gm13212 UTSW 4 145622556 missense possibly damaging 0.49
R0090:Gm13212 UTSW 4 145622625 nonsense probably null
R1617:Gm13212 UTSW 4 145624307 utr 3 prime probably benign
R1851:Gm13212 UTSW 4 145624250 unclassified probably benign
R1864:Gm13212 UTSW 4 145622428 missense possibly damaging 0.92
R2093:Gm13212 UTSW 4 145622569 missense probably benign 0.02
R2132:Gm13212 UTSW 4 145624233 unclassified probably benign
R2240:Gm13212 UTSW 4 145585321 start gained probably benign
R4177:Gm13212 UTSW 4 145620655 missense probably damaging 1.00
R4584:Gm13212 UTSW 4 145617177 critical splice donor site probably null
R4991:Gm13212 UTSW 4 145622334 missense probably benign 0.31
R5164:Gm13212 UTSW 4 145622205 missense probably damaging 1.00
R6175:Gm13212 UTSW 4 145624241 unclassified probably benign
R6176:Gm13212 UTSW 4 145624058 nonsense probably null
R6498:Gm13212 UTSW 4 145622889 missense probably damaging 0.98
R6984:Gm13212 UTSW 4 145620616 missense probably damaging 1.00
R7134:Gm13212 UTSW 4 145622805 missense possibly damaging 0.93
R7931:Gm13212 UTSW 4 145622556 missense possibly damaging 0.49
R8017:Gm13212 UTSW 4 145622568 missense probably benign 0.28
R8282:Gm13212 UTSW 4 145622977 missense possibly damaging 0.94
R9320:Gm13212 UTSW 4 145622586 missense possibly damaging 0.77
R9358:Gm13212 UTSW 4 145623043 missense possibly damaging 0.79
R9435:Gm13212 UTSW 4 145622475 missense
V5622:Gm13212 UTSW 4 145585321 start gained probably benign
Z1176:Gm13212 UTSW 4 145622968 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCTTATTTGTCCCAGCTTATGCAAAGT -3'
(R):5'- TGGTTCGAGTATTGAAGAGAGCTGTGAT -3'

Sequencing Primer
(F):5'- cctcttttccattctttgtccc -3'
(R):5'- ATTGAAGAGAGCTGTGATAAGTTTTG -3'
Posted On 2013-11-08