Incidental Mutation 'R0904:Gm3259'
ID 83243
Institutional Source Beutler Lab
Gene Symbol Gm3259
Ensembl Gene ENSMUSG00000079424
Gene Name predicted gene 3259
Synonyms
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock # R0904 (G1)
Quality Score 110
Status Not validated
Chromosome 5
Chromosomal Location 95305911-95343917 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 95341327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 210 (T210P)
Ref Sequence ENSEMBL: ENSMUSP00000141099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101015] [ENSMUST00000160045] [ENSMUST00000185432]
AlphaFold D3YUK0
Predicted Effect probably damaging
Transcript: ENSMUST00000101015
AA Change: T210P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098577
Gene: ENSMUSG00000079424
AA Change: T210P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 388 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160045
SMART Domains Protein: ENSMUSP00000124254
Gene: ENSMUSG00000079424

DomainStartEndE-ValueType
SCOP:d1a4ya_ 62 191 1e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161225
Predicted Effect probably damaging
Transcript: ENSMUST00000185432
AA Change: T210P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141099
Gene: ENSMUSG00000079424
AA Change: T210P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 359 2e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Gm3259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Gm3259 APN 5 95341399 missense probably benign 0.41
IGL03148:Gm3259 APN 5 95341318 missense possibly damaging 0.94
R6019:Gm3259 UTSW 5 95340213 missense probably damaging 0.99
R7527:Gm3259 UTSW 5 95342550 missense probably benign 0.03
R8493:Gm3259 UTSW 5 95340233 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCAGCGTCTGAAGGTCATAGTCAAC -3'
(R):5'- GGCAGGCATCATGGACCACTAATC -3'

Sequencing Primer
(F):5'- GTCTGAAGGTCATAGTCAACCTGTC -3'
(R):5'- AGGACCTGATTCATGTAGTCTCTTAG -3'
Posted On 2013-11-08