Incidental Mutation 'R0904:Mapk10'
ID 83244
Institutional Source Beutler Lab
Gene Symbol Mapk10
Ensembl Gene ENSMUSG00000046709
Gene Name mitogen-activated protein kinase 10
Synonyms p493F12, JNK3, Serk2, C230008H04Rik
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 102907948-103211334 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 102987280 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086854] [ENSMUST00000112846] [ENSMUST00000112847] [ENSMUST00000112848] [ENSMUST00000128869] [ENSMUST00000133069] [ENSMUST00000141573] [ENSMUST00000170792]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000086854
SMART Domains Protein: ENSMUSP00000084065
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
S_TKc 64 359 5.76e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112846
SMART Domains Protein: ENSMUSP00000108467
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112847
SMART Domains Protein: ENSMUSP00000108468
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112848
SMART Domains Protein: ENSMUSP00000108469
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
S_TKc 94 389 4.37e-88 SMART
low complexity region 453 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128869
SMART Domains Protein: ENSMUSP00000143448
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
S_TKc 4 178 7.4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133069
SMART Domains Protein: ENSMUSP00000143609
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
S_TKc 64 252 1.4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141573
SMART Domains Protein: ENSMUSP00000142798
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
Pfam:Pkinase 64 125 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170792
SMART Domains Protein: ENSMUSP00000127193
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199275
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals and are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. They are resistant to kainic acid induced seizures and show increased resistance to MPTP induced Parkinson's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Mapk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Mapk10 APN 5 102926152 splice site probably benign
IGL01791:Mapk10 APN 5 102996648 missense probably damaging 1.00
IGL01885:Mapk10 APN 5 102996589 missense probably damaging 1.00
IGL02192:Mapk10 APN 5 102989647 missense probably damaging 0.97
IGL02260:Mapk10 APN 5 103038668 missense probably benign 0.09
IGL02409:Mapk10 APN 5 102928230 missense possibly damaging 0.50
IGL03148:Mapk10 APN 5 102926105 missense probably damaging 1.00
R1067:Mapk10 UTSW 5 102991857 splice site probably benign
R1592:Mapk10 UTSW 5 103038621 missense possibly damaging 0.89
R1812:Mapk10 UTSW 5 102913262 missense probably damaging 1.00
R2364:Mapk10 UTSW 5 103038641 missense possibly damaging 0.81
R2866:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R4622:Mapk10 UTSW 5 102989724 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4866:Mapk10 UTSW 5 102963525 missense probably damaging 1.00
R5901:Mapk10 UTSW 5 102913292 missense probably damaging 1.00
R5986:Mapk10 UTSW 5 103038580 missense probably benign 0.33
R6000:Mapk10 UTSW 5 102966475 missense probably damaging 1.00
R6000:Mapk10 UTSW 5 102966476 missense probably damaging 1.00
R7375:Mapk10 UTSW 5 102976390 missense probably null 0.26
R7460:Mapk10 UTSW 5 103038577 missense probably benign 0.37
R7753:Mapk10 UTSW 5 103038553 nonsense probably null
R7879:Mapk10 UTSW 5 102963496 missense probably benign 0.10
R7935:Mapk10 UTSW 5 102991926 missense possibly damaging 0.92
R8059:Mapk10 UTSW 5 102966612 missense probably damaging 1.00
R8846:Mapk10 UTSW 5 102996655 missense probably damaging 1.00
R9030:Mapk10 UTSW 5 102996633 missense probably damaging 1.00
R9106:Mapk10 UTSW 5 103038576 missense probably damaging 1.00
R9115:Mapk10 UTSW 5 103038666 missense
R9398:Mapk10 UTSW 5 102913286 missense probably damaging 1.00
Z1176:Mapk10 UTSW 5 102991887 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAACCCACTTACCCAAGTTTCTG -3'
(R):5'- TTTAGCCGACACCTGCCTGAAC -3'

Sequencing Primer
(F):5'- ACTTACCCAAGTTTCTGCTTCTG -3'
(R):5'- TAGTTTGGGCATCCACACAG -3'
Posted On 2013-11-08