Incidental Mutation 'R0904:Spdye4b'
ID 83245
Institutional Source Beutler Lab
Gene Symbol Spdye4b
Ensembl Gene ENSMUSG00000029586
Gene Name speedy/RINGO cell cycle regulator family, member E4B
Synonyms 4933411G11Rik
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 143181017-143205075 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 143195668 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031574] [ENSMUST00000159781]
AlphaFold Q8CDE8
Predicted Effect probably benign
Transcript: ENSMUST00000031574
SMART Domains Protein: ENSMUSP00000031574
Gene: ENSMUSG00000029586

DomainStartEndE-ValueType
low complexity region 40 48 N/A INTRINSIC
Pfam:Spy1 84 213 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159781
SMART Domains Protein: ENSMUSP00000125524
Gene: ENSMUSG00000029586

DomainStartEndE-ValueType
low complexity region 40 48 N/A INTRINSIC
Pfam:Spy1 84 213 1.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198090
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Spdye4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Spdye4b APN 5 143202411 missense probably benign 0.41
R0080:Spdye4b UTSW 5 143195675 missense probably damaging 1.00
R0082:Spdye4b UTSW 5 143195675 missense probably damaging 1.00
R1474:Spdye4b UTSW 5 143195717 missense probably damaging 1.00
R2484:Spdye4b UTSW 5 143202093 missense possibly damaging 0.95
R3838:Spdye4b UTSW 5 143192329 missense probably benign
R4766:Spdye4b UTSW 5 143196334 missense probably damaging 0.99
R5303:Spdye4b UTSW 5 143202403 missense probably benign 0.33
R5569:Spdye4b UTSW 5 143202421 missense probably benign 0.15
R5778:Spdye4b UTSW 5 143202387 missense probably damaging 1.00
R7310:Spdye4b UTSW 5 143202348 missense probably damaging 0.99
R7347:Spdye4b UTSW 5 143202390 missense possibly damaging 0.93
R7532:Spdye4b UTSW 5 143194897 missense possibly damaging 0.75
R7860:Spdye4b UTSW 5 143194854 missense possibly damaging 0.73
R8135:Spdye4b UTSW 5 143195022 missense probably damaging 0.99
R8872:Spdye4b UTSW 5 143202060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTATTCCAAGCCTCCTGCCAAG -3'
(R):5'- AGCCCCTGTCCACTCTGTAAGATG -3'

Sequencing Primer
(F):5'- AGAGGCTCCTTGCCATACC -3'
(R):5'- ACTCTGTAAGATGCTGCAAGTCC -3'
Posted On 2013-11-08