Incidental Mutation 'R0904:Vmn1r52'
ID 83247
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Name vomeronasal 1 receptor 52
Synonyms V1ra7, VN3
MMRRC Submission 039062-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R0904 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 90155698-90156627 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90156446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 71 (M71K)
Ref Sequence ENSEMBL: ENSMUSP00000154194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832] [ENSMUST00000226520] [ENSMUST00000227100] [ENSMUST00000227578] [ENSMUST00000227893] [ENSMUST00000228385] [ENSMUST00000228394] [ENSMUST00000228665]
AlphaFold Q9EP79
Predicted Effect possibly damaging
Transcript: ENSMUST00000079832
AA Change: M250K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: M250K

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Predicted Effect possibly damaging
Transcript: ENSMUST00000226520
AA Change: M250K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000227100
AA Change: M50K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000227578
AA Change: M71K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227893
AA Change: M250K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228385
AA Change: M62K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228394
AA Change: M250K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228665
AA Change: M250K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,975,118 (GRCm39) probably benign Het
Abca13 T C 11: 9,248,740 (GRCm39) V2829A probably benign Het
Adk G T 14: 21,142,496 (GRCm39) D26Y probably damaging Het
Bpifb9a T C 2: 154,106,145 (GRCm39) probably benign Het
Dap G A 15: 31,272,526 (GRCm39) probably benign Het
Eqtn A T 4: 94,795,892 (GRCm39) S270T probably benign Het
Fam193a A G 5: 34,619,487 (GRCm39) D764G probably damaging Het
Fbxl6 A T 15: 76,421,283 (GRCm39) probably null Het
Gtf3c1 A T 7: 125,268,014 (GRCm39) probably benign Het
H2-D1 G C 17: 35,482,837 (GRCm39) M122I probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Map1s C A 8: 71,366,832 (GRCm39) P579Q probably damaging Het
Mapk10 A G 5: 103,135,146 (GRCm39) probably benign Het
Mllt6 C G 11: 97,555,824 (GRCm39) C51W probably damaging Het
Mzf1 C A 7: 12,786,698 (GRCm39) R124L possibly damaging Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Neurod2 G T 11: 98,218,147 (GRCm39) T339K probably benign Het
Nfya G A 17: 48,702,815 (GRCm39) Q29* probably null Het
Nipbl A T 15: 8,391,202 (GRCm39) D257E probably benign Het
Pate5 T C 9: 35,750,366 (GRCm39) D102G probably damaging Het
Pex5 G A 6: 124,376,896 (GRCm39) probably benign Het
Pramel47 A C 5: 95,489,186 (GRCm39) T210P probably damaging Het
Prx T A 7: 27,217,719 (GRCm39) F879Y probably damaging Het
Resf1 G A 6: 149,229,767 (GRCm39) A938T probably damaging Het
Scai G A 2: 38,965,164 (GRCm39) T560M possibly damaging Het
Slfn10-ps T C 11: 82,926,235 (GRCm39) noncoding transcript Het
Spdye4b A G 5: 143,181,423 (GRCm39) probably benign Het
Ss18l1 A G 2: 179,701,147 (GRCm39) Y287C probably damaging Het
Tpbg C A 9: 85,726,617 (GRCm39) F195L unknown Het
Trbv16 T C 6: 41,128,781 (GRCm39) probably benign Het
Unc5c A G 3: 141,509,601 (GRCm39) T620A probably benign Het
Vangl1 A G 3: 102,091,310 (GRCm39) S259P probably damaging Het
Vmn2r23 A T 6: 123,719,094 (GRCm39) I816F probably damaging Het
Zfp268 T C 4: 145,348,745 (GRCm39) Y61H possibly damaging Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90,155,905 (GRCm39) missense probably benign
IGL02102:Vmn1r52 APN 6 90,156,189 (GRCm39) missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90,156,126 (GRCm39) nonsense probably null
IGL02938:Vmn1r52 APN 6 90,156,295 (GRCm39) missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90,156,593 (GRCm39) missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90,156,593 (GRCm39) missense possibly damaging 0.96
R2190:Vmn1r52 UTSW 6 90,156,151 (GRCm39) missense probably benign 0.12
R4184:Vmn1r52 UTSW 6 90,156,219 (GRCm39) missense probably benign 0.00
R4906:Vmn1r52 UTSW 6 90,155,930 (GRCm39) missense possibly damaging 0.63
R5475:Vmn1r52 UTSW 6 90,155,894 (GRCm39) missense probably benign 0.04
R5689:Vmn1r52 UTSW 6 90,156,232 (GRCm39) missense possibly damaging 0.95
R5740:Vmn1r52 UTSW 6 90,156,176 (GRCm39) missense probably benign 0.02
R7263:Vmn1r52 UTSW 6 90,156,535 (GRCm39) missense probably benign 0.00
R7337:Vmn1r52 UTSW 6 90,156,605 (GRCm39) missense probably benign 0.31
R7374:Vmn1r52 UTSW 6 90,156,118 (GRCm39) missense probably benign 0.08
R8161:Vmn1r52 UTSW 6 90,156,239 (GRCm39) missense possibly damaging 0.73
R8699:Vmn1r52 UTSW 6 90,155,742 (GRCm39) missense probably benign 0.02
R8747:Vmn1r52 UTSW 6 90,156,451 (GRCm39) missense probably benign 0.36
R9721:Vmn1r52 UTSW 6 90,156,008 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACACTGTTGGCTTTCAGGAATG -3'
(R):5'- TCAGATTGTGACAAGCCTGATCACC -3'

Sequencing Primer
(F):5'- CAGGAATGTCTTTGTTATTGGTCTC -3'
(R):5'- TGCCAAATGATGGCTCACTG -3'
Posted On 2013-11-08