Mutagenetix > Incidental Mutation

Incidental Mutation 'R0904:Vmn2r23'

83248

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

039062-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R0904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123742135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 816 (I816F)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: I816F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: I816F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.2%
20x: 94.7%

Validation Efficiency

89% (34/38)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	G	8: 79,248,489		probably benign	Het
2810474O19Rik	G	A	6: 149,328,269	A938T	probably damaging	Het
9230110F15Rik	T	C	9: 35,839,070	D102G	probably damaging	Het
Abca13	T	C	11: 9,298,740	V2829A	probably benign	Het
Adk	G	T	14: 21,092,428	D26Y	probably damaging	Het
Bpifb9a	T	C	2: 154,264,225		probably benign	Het
Dap	G	A	15: 31,272,380		probably benign	Het
Eqtn	A	T	4: 94,907,655	S270T	probably benign	Het
Fam193a	A	G	5: 34,462,143	D764G	probably damaging	Het
Fbxl6	A	T	15: 76,537,083		probably null	Het
Gm13212	T	C	4: 145,622,175	Y61H	possibly damaging	Het
Gm3259	A	C	5: 95,341,327	T210P	probably damaging	Het
Gtf3c1	A	T	7: 125,668,842		probably benign	Het
H2-D1	G	C	17: 35,263,861	M122I	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map1s	C	A	8: 70,914,188	P579Q	probably damaging	Het
Mapk10	A	G	5: 102,987,280		probably benign	Het
Mllt6	C	G	11: 97,664,998	C51W	probably damaging	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Neurod2	G	T	11: 98,327,321	T339K	probably benign	Het
Nfya	G	A	17: 48,395,787	Q29*	probably null	Het
Nipbl	A	T	15: 8,361,718	D257E	probably benign	Het
Pex5	G	A	6: 124,399,937		probably benign	Het
Prx	T	A	7: 27,518,294	F879Y	probably damaging	Het
Scai	G	A	2: 39,075,152	T560M	possibly damaging	Het
Slfn10-ps	T	C	11: 83,035,409		noncoding transcript	Het
Spdye4b	A	G	5: 143,195,668		probably benign	Het
Ss18l1	A	G	2: 180,059,354	Y287C	probably damaging	Het
Tpbg	C	A	9: 85,844,564	F195L	unknown	Het
Trbv16	T	C	6: 41,151,847		probably benign	Het
Unc5c	A	G	3: 141,803,840	T620A	probably benign	Het
Vangl1	A	G	3: 102,183,994	S259P	probably damaging	Het
Vmn1r52	T	A	6: 90,179,464	M71K	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGGGTCCACCCTTGCATTCTATTG -3'
(R):5'- AGGATTGCAGAGTCAGATGCCATTG -3'

Sequencing Primer
(F):5'- CATTCTATTGTGTTCTGGGCTAC -3'
(R):5'- CAGAGTCAGATGCCATTGTTTAG -3'

Posted On

2013-11-08