Incidental Mutation 'R0904:Pex5'
ID 83249
Institutional Source Beutler Lab
Gene Symbol Pex5
Ensembl Gene ENSMUSG00000005069
Gene Name peroxisomal biogenesis factor 5
Synonyms ESTM1, peroxisome biogenesis factor 5, PTS1R, Pxr1
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124396816-124415067 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 124399937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035861] [ENSMUST00000080557] [ENSMUST00000112530] [ENSMUST00000112531] [ENSMUST00000112532]
AlphaFold O09012
Predicted Effect probably benign
Transcript: ENSMUST00000035861
SMART Domains Protein: ENSMUSP00000049132
Gene: ENSMUSG00000005069

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080557
SMART Domains Protein: ENSMUSP00000079398
Gene: ENSMUSG00000005069

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112530
SMART Domains Protein: ENSMUSP00000108149
Gene: ENSMUSG00000005069

DomainStartEndE-ValueType
low complexity region 224 240 N/A INTRINSIC
TPR 364 397 2.66e0 SMART
low complexity region 436 447 N/A INTRINSIC
TPR 481 514 1.76e-5 SMART
TPR 515 548 1.49e-3 SMART
TPR 549 582 3.87e-2 SMART
low complexity region 615 626 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112531
SMART Domains Protein: ENSMUSP00000108150
Gene: ENSMUSG00000005069

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112532
SMART Domains Protein: ENSMUSP00000108151
Gene: ENSMUSG00000005069

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156415
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced size, muscle weakness, respiratory distress, and retarded development and defects of the kidney, liver, brain, and intestine associated with lack of peroxisomes, and die within 3-4 days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Pex5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Pex5 APN 6 124398380 missense probably damaging 1.00
IGL02027:Pex5 APN 6 124398888 missense probably benign 0.20
IGL02041:Pex5 APN 6 124405281 splice site probably benign
IGL02128:Pex5 APN 6 124398460 missense probably damaging 1.00
IGL02507:Pex5 APN 6 124413305 missense probably benign
IGL02539:Pex5 APN 6 124403224 missense probably benign 0.02
IGL03180:Pex5 APN 6 124413563 splice site probably benign
G1Funyon:Pex5 UTSW 6 124405183 missense probably benign 0.02
R0143:Pex5 UTSW 6 124398489 missense probably damaging 1.00
R0600:Pex5 UTSW 6 124404637 missense probably benign 0.10
R1970:Pex5 UTSW 6 124414405 missense probably damaging 1.00
R4628:Pex5 UTSW 6 124403120 missense possibly damaging 0.90
R4879:Pex5 UTSW 6 124398363 missense probably benign 0.02
R5068:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5069:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5339:Pex5 UTSW 6 124398004 missense probably benign 0.02
R6433:Pex5 UTSW 6 124413613 missense possibly damaging 0.81
R6825:Pex5 UTSW 6 124414381 missense probably damaging 0.98
R6851:Pex5 UTSW 6 124403154 missense possibly damaging 0.92
R7148:Pex5 UTSW 6 124405272 missense probably benign 0.10
R7286:Pex5 UTSW 6 124398063 nonsense probably null
R7673:Pex5 UTSW 6 124399383 missense probably damaging 0.98
R7752:Pex5 UTSW 6 124403901 missense probably damaging 0.99
R7752:Pex5 UTSW 6 124414018 missense probably benign 0.03
R7793:Pex5 UTSW 6 124399341 missense probably benign 0.00
R8301:Pex5 UTSW 6 124405183 missense probably benign 0.02
R8964:Pex5 UTSW 6 124398781 missense probably benign 0.00
Z1177:Pex5 UTSW 6 124398386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCGGAATCAAGCCTCTCACAC -3'
(R):5'- TGAAGAAGGGCTGCATCGACTG -3'

Sequencing Primer
(F):5'- TCTGAGCCACGACGACTTG -3'
(R):5'- AGACCTGCCCAATGCTGTG -3'
Posted On 2013-11-08