Incidental Mutation 'R0904:Mzf1'
ID 83251
Institutional Source Beutler Lab
Gene Symbol Mzf1
Ensembl Gene ENSMUSG00000030380
Gene Name myeloid zinc finger 1
Synonyms Znf42, Zfp121, Zfp98, Mzf2
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 13042303-13054764 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 13052771 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 124 (R124L)
Ref Sequence ENSEMBL: ENSMUSP00000138163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069289] [ENSMUST00000182087] [ENSMUST00000182490] [ENSMUST00000182515]
AlphaFold S4R1L6
Predicted Effect possibly damaging
Transcript: ENSMUST00000069289
AA Change: R124L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069122
Gene: ENSMUSG00000030380
AA Change: R124L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182087
AA Change: R124L

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138163
Gene: ENSMUSG00000030380
AA Change: R124L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 152 9.06e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182293
Predicted Effect possibly damaging
Transcript: ENSMUST00000182490
AA Change: R203L

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138271
Gene: ENSMUSG00000030380
AA Change: R203L

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
SCAN 120 232 1.18e-70 SMART
ZnF_C2H2 436 458 4.87e-4 SMART
ZnF_C2H2 464 486 1.95e-3 SMART
ZnF_C2H2 492 514 1.18e-2 SMART
ZnF_C2H2 520 542 8.6e-5 SMART
ZnF_C2H2 565 587 1.79e-2 SMART
ZnF_C2H2 593 615 7.15e-2 SMART
ZnF_C2H2 621 643 8.47e-4 SMART
ZnF_C2H2 649 671 2.79e-4 SMART
ZnF_C2H2 677 699 1.6e-4 SMART
ZnF_C2H2 705 727 1.67e-2 SMART
ZnF_C2H2 733 755 3.44e-4 SMART
ZnF_C2H2 761 783 2.84e-5 SMART
ZnF_C2H2 789 811 2.4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182515
AA Change: R124L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138387
Gene: ENSMUSG00000030380
AA Change: R124L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210727
Meta Mutation Damage Score 0.1109 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype PHENOTYPE: Homozygous mutants are prone to late-onset (>2 yr) neoplasias characterized by infiltration, enlargement and disruption of the liver by monomorphic cells of myeloid origin; hemopoietic progenitors show increased ability to sustain long-term hemopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Mzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Mzf1 APN 7 13044616 missense possibly damaging 0.85
IGL01728:Mzf1 APN 7 13051727 splice site probably benign
IGL02194:Mzf1 APN 7 13043720 missense possibly damaging 0.53
IGL02256:Mzf1 APN 7 13052737 splice site probably benign
IGL02584:Mzf1 APN 7 13052817 missense probably damaging 0.98
IGL02678:Mzf1 APN 7 13052909 missense probably benign 0.00
R0903:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0905:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1128:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1131:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1280:Mzf1 UTSW 7 13053083 missense probably damaging 0.96
R1400:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1640:Mzf1 UTSW 7 13043270 makesense probably null
R1687:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R4014:Mzf1 UTSW 7 13043956 missense possibly damaging 0.47
R4721:Mzf1 UTSW 7 13043296 missense possibly damaging 0.52
R4721:Mzf1 UTSW 7 13043521 missense possibly damaging 0.53
R5511:Mzf1 UTSW 7 13051599 missense possibly damaging 0.95
R5611:Mzf1 UTSW 7 13044627 utr 3 prime probably benign
R5728:Mzf1 UTSW 7 13044058 missense probably benign 0.00
R5868:Mzf1 UTSW 7 13053189 missense probably benign 0.00
R6283:Mzf1 UTSW 7 13053369 intron probably benign
R7059:Mzf1 UTSW 7 13053058 missense probably damaging 0.96
R7066:Mzf1 UTSW 7 13043563 missense possibly damaging 0.92
R7763:Mzf1 UTSW 7 13044091 missense probably damaging 1.00
R8157:Mzf1 UTSW 7 13044352 missense probably damaging 1.00
R8870:Mzf1 UTSW 7 13052909 missense probably benign 0.00
R9063:Mzf1 UTSW 7 13053078 missense probably damaging 1.00
R9113:Mzf1 UTSW 7 13044352 missense probably damaging 1.00
R9252:Mzf1 UTSW 7 13043720 missense probably benign 0.33
R9289:Mzf1 UTSW 7 13051607 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCATCCAAAGTCCTGAACTTCCCC -3'
(R):5'- GCTACGCCCAGAAGTACATTCCAAG -3'

Sequencing Primer
(F):5'- CTCTTTTGACCTTGAGCAGAAAGC -3'
(R):5'- TACATTCCAAGGAACAGGTGC -3'
Posted On 2013-11-08