Incidental Mutation 'R0904:Prx'
ID 83252
Institutional Source Beutler Lab
Gene Symbol Prx
Ensembl Gene ENSMUSG00000053198
Gene Name periaxin
Synonyms L-Periaxin
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27499324-27520214 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 27518294 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 879 (F879Y)
Ref Sequence ENSEMBL: ENSMUSP00000096241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108353] [ENSMUST00000108355] [ENSMUST00000125990]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000065487
AA Change: F879Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: F879Y

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098644
AA Change: F879Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: F879Y

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108353
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125990
AA Change: F740Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Prx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prx APN 7 27519419 missense probably benign 0.12
IGL01702:Prx APN 7 27519787 missense probably benign 0.00
IGL02012:Prx APN 7 27517901 missense probably damaging 1.00
IGL02214:Prx APN 7 27518912 missense probably damaging 1.00
IGL02498:Prx APN 7 27518072 missense probably damaging 1.00
IGL03029:Prx APN 7 27508061 nonsense probably null
R0522:Prx UTSW 7 27518195 missense probably damaging 0.99
R0655:Prx UTSW 7 27517421 missense probably damaging 1.00
R1161:Prx UTSW 7 27519677 missense probably damaging 1.00
R1170:Prx UTSW 7 27518007 nonsense probably null
R1270:Prx UTSW 7 27518930 missense probably damaging 0.96
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1536:Prx UTSW 7 27517258 missense probably damaging 0.99
R1721:Prx UTSW 7 27517523 missense probably benign 0.19
R1815:Prx UTSW 7 27516665 missense probably damaging 1.00
R1848:Prx UTSW 7 27518888 missense possibly damaging 0.70
R1894:Prx UTSW 7 27519110 missense possibly damaging 0.68
R2179:Prx UTSW 7 27517985 missense probably benign
R2207:Prx UTSW 7 27516788 missense probably damaging 1.00
R2312:Prx UTSW 7 27516626 missense possibly damaging 0.87
R2356:Prx UTSW 7 27507859 start gained probably benign
R2519:Prx UTSW 7 27518243 missense probably benign 0.43
R2912:Prx UTSW 7 27516229 missense probably damaging 1.00
R4717:Prx UTSW 7 27516727 missense probably benign 0.07
R4868:Prx UTSW 7 27517579 missense probably benign 0.01
R5153:Prx UTSW 7 27518476 missense probably damaging 1.00
R5418:Prx UTSW 7 27517274 missense probably damaging 0.99
R5653:Prx UTSW 7 27517604 missense probably damaging 1.00
R5895:Prx UTSW 7 27515284 missense probably damaging 1.00
R6022:Prx UTSW 7 27517573 missense probably damaging 1.00
R6112:Prx UTSW 7 27516548 missense probably damaging 1.00
R6223:Prx UTSW 7 27516836 missense probably damaging 1.00
R6560:Prx UTSW 7 27515321 missense probably damaging 1.00
R6888:Prx UTSW 7 27519634 missense possibly damaging 0.73
R7530:Prx UTSW 7 27507972 missense probably damaging 1.00
R7854:Prx UTSW 7 27516641 missense probably damaging 1.00
R8258:Prx UTSW 7 27519383 missense probably damaging 1.00
R8259:Prx UTSW 7 27519383 missense probably damaging 1.00
R8831:Prx UTSW 7 27518113 missense probably damaging 0.99
R9335:Prx UTSW 7 27518071 missense probably damaging 1.00
RF009:Prx UTSW 7 27518960 missense probably damaging 1.00
X0028:Prx UTSW 7 27517733 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTTGCCCAAGATGACCATGCCC -3'
(R):5'- AGGCTTGCTATCAGCTACTTCCACC -3'

Sequencing Primer
(F):5'- ACTGAGGCATCCCATGTTG -3'
(R):5'- CATCCAGGCTGAGCTGTG -3'
Posted On 2013-11-08