Incidental Mutation 'R0904:Map1s'
ID 83254
Institutional Source Beutler Lab
Gene Symbol Map1s
Ensembl Gene ENSMUSG00000019261
Gene Name microtubule-associated protein 1S
Synonyms Bpy2ip1, Map8, VCY2IP1, 6430517J16Rik, Mtap1s
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0904 (G1)
Quality Score 115
Status Validated
Chromosome 8
Chromosomal Location 70905932-70917529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70914188 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 579 (P579Q)
Ref Sequence ENSEMBL: ENSMUSP00000019405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019405] [ENSMUST00000211910] [ENSMUST00000212227] [ENSMUST00000212511] [ENSMUST00000213001]
AlphaFold Q8C052
Predicted Effect probably damaging
Transcript: ENSMUST00000019405
AA Change: P579Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019405
Gene: ENSMUSG00000019261
AA Change: P579Q

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 125 137 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
SCOP:d1e5da2 237 300 2e-3 SMART
Blast:Lactamase_B 244 475 1e-85 BLAST
low complexity region 536 550 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
low complexity region 715 734 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211880
Predicted Effect probably benign
Transcript: ENSMUST00000211910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212143
Predicted Effect possibly damaging
Transcript: ENSMUST00000212227
AA Change: P579Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212697
Predicted Effect probably benign
Transcript: ENSMUST00000213001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213083
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective biogenesis and degradation of autophagosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Map1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Map1s APN 8 70906029 unclassified probably benign
IGL01012:Map1s APN 8 70913910 missense probably benign 0.00
IGL01729:Map1s APN 8 70913068 missense probably damaging 1.00
IGL03158:Map1s APN 8 70914734 missense probably damaging 0.97
E0374:Map1s UTSW 8 70906017 unclassified probably benign
R0026:Map1s UTSW 8 70914638 missense probably damaging 1.00
R0172:Map1s UTSW 8 70914968 missense probably benign 0.00
R0571:Map1s UTSW 8 70912907 missense probably damaging 1.00
R0666:Map1s UTSW 8 70914052 missense possibly damaging 0.88
R1617:Map1s UTSW 8 70913451 missense probably damaging 1.00
R1834:Map1s UTSW 8 70916411 missense probably damaging 0.97
R2134:Map1s UTSW 8 70913882 missense probably benign 0.00
R2143:Map1s UTSW 8 70910964 missense probably damaging 1.00
R3413:Map1s UTSW 8 70912519 missense probably damaging 0.99
R3870:Map1s UTSW 8 70917101 missense possibly damaging 0.82
R5555:Map1s UTSW 8 70917107 missense probably damaging 0.97
R5784:Map1s UTSW 8 70914358 missense probably damaging 1.00
R6630:Map1s UTSW 8 70913798 missense probably damaging 1.00
R7379:Map1s UTSW 8 70913575 missense possibly damaging 0.87
R7569:Map1s UTSW 8 70913498 missense probably benign 0.05
R8415:Map1s UTSW 8 70913266 missense probably damaging 1.00
R8440:Map1s UTSW 8 70912519 missense probably damaging 0.99
R8784:Map1s UTSW 8 70906265 missense unknown
R8974:Map1s UTSW 8 70914350 missense probably damaging 1.00
R9161:Map1s UTSW 8 70913606 missense probably damaging 1.00
Z1088:Map1s UTSW 8 70916449 missense possibly damaging 0.66
Z1177:Map1s UTSW 8 70914517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCATTGCCAACAGGAGTACAG -3'
(R):5'- TCCACATCATGAGGAGACGTGGAG -3'

Sequencing Primer
(F):5'- GCCACTCGTGACCAGAAG -3'
(R):5'- AGGACTTGCTCGAAAGACAC -3'
Posted On 2013-11-08