Incidental Mutation 'R0904:Tpbg'
ID 83256
Institutional Source Beutler Lab
Gene Symbol Tpbg
Ensembl Gene ENSMUSG00000035274
Gene Name trophoblast glycoprotein
Synonyms 5T4 oncofetal antigen, 5T4
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.633) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 85842380-85847040 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 85844564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 195 (F195L)
Ref Sequence ENSEMBL: ENSMUSP00000096101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006559] [ENSMUST00000098500]
AlphaFold Q9Z0L0
Predicted Effect unknown
Transcript: ENSMUST00000006559
AA Change: F195L
SMART Domains Protein: ENSMUSP00000006559
Gene: ENSMUSG00000035274
AA Change: F195L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069896
SMART Domains Protein: ENSMUSP00000126873
Gene: ENSMUSG00000056031

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 68 88 N/A INTRINSIC
low complexity region 103 122 N/A INTRINSIC
low complexity region 150 193 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098500
AA Change: F195L
SMART Domains Protein: ENSMUSP00000096101
Gene: ENSMUSG00000035274
AA Change: F195L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189191
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low penetrance hydrocephaly and premature death. Embryonic stem cells isolated from these mice exhibit impaired mesenchyme differentiation and reduced chemotaxis following differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Tpbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Tpbg APN 9 85844092 missense unknown
IGL01789:Tpbg APN 9 85844901 missense probably benign 0.00
IGL01987:Tpbg APN 9 85845199 missense probably damaging 1.00
R0399:Tpbg UTSW 9 85844938 missense possibly damaging 0.63
R0418:Tpbg UTSW 9 85844750 nonsense probably null
R1748:Tpbg UTSW 9 85844376 missense probably damaging 1.00
R3744:Tpbg UTSW 9 85845162 missense probably damaging 1.00
R3836:Tpbg UTSW 9 85843114 intron probably benign
R3837:Tpbg UTSW 9 85843114 intron probably benign
R3839:Tpbg UTSW 9 85843114 intron probably benign
R5221:Tpbg UTSW 9 85844425 missense probably damaging 1.00
R6488:Tpbg UTSW 9 85844485 missense possibly damaging 0.70
R7192:Tpbg UTSW 9 85844032 nonsense probably null
R7462:Tpbg UTSW 9 85844850 missense possibly damaging 0.56
R8481:Tpbg UTSW 9 85844085 missense unknown
R8895:Tpbg UTSW 9 85844467 missense possibly damaging 0.50
R9092:Tpbg UTSW 9 85844863 missense possibly damaging 0.87
R9319:Tpbg UTSW 9 85843938 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTTAAGTGCGTGAACCGCAACC -3'
(R):5'- TAGGTCAGGCTCACCAGGGAATTG -3'

Sequencing Primer
(F):5'- TTCCTTACCGGCAACCAGATG -3'
(R):5'- CACCAGGGAATTGTTCCTGAG -3'
Posted On 2013-11-08