Incidental Mutation 'R0904:Slfn10-ps'
ID 83259
Institutional Source Beutler Lab
Gene Symbol Slfn10-ps
Ensembl Gene ENSMUSG00000072621
Gene Name schlafen 10, pseudogene
Synonyms
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83028130-83040042 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 83035409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100716
SMART Domains Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AlbA_2 142 278 1.3e-13 PFAM
Pfam:DUF2075 529 697 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152760
SMART Domains Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AAA_4 142 280 1.8e-14 PFAM
Pfam:DUF2075 529 693 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215473
Meta Mutation Damage Score 0.3555 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Slfn10-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slfn10-ps APN 11 83035529 unclassified noncoding transcript
IGL00826:Slfn10-ps APN 11 83035259 unclassified noncoding transcript
IGL01022:Slfn10-ps APN 11 83035527 unclassified noncoding transcript
IGL01409:Slfn10-ps APN 11 83035496 unclassified noncoding transcript
IGL01664:Slfn10-ps APN 11 83035935 unclassified noncoding transcript
IGL01700:Slfn10-ps APN 11 83029112 unclassified noncoding transcript
IGL02093:Slfn10-ps APN 11 83032190 unclassified noncoding transcript
IGL02253:Slfn10-ps APN 11 83029064 unclassified noncoding transcript
IGL02364:Slfn10-ps APN 11 83032291 unclassified noncoding transcript
IGL02466:Slfn10-ps APN 11 83030264 unclassified noncoding transcript
IGL02636:Slfn10-ps APN 11 83030145 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 83035542 unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 83035542 unclassified noncoding transcript
R0164:Slfn10-ps UTSW 11 83035302 unclassified noncoding transcript
R0362:Slfn10-ps UTSW 11 83035774 unclassified noncoding transcript
R0382:Slfn10-ps UTSW 11 83029534 unclassified noncoding transcript
R0597:Slfn10-ps UTSW 11 83035653 unclassified noncoding transcript
R0812:Slfn10-ps UTSW 11 83035562 unclassified noncoding transcript
R1552:Slfn10-ps UTSW 11 83029850 unclassified noncoding transcript
R1703:Slfn10-ps UTSW 11 83030043 unclassified noncoding transcript
R2127:Slfn10-ps UTSW 11 83030342 unclassified noncoding transcript
R2151:Slfn10-ps UTSW 11 83035685 unclassified noncoding transcript
R2302:Slfn10-ps UTSW 11 83028930 unclassified noncoding transcript
R3114:Slfn10-ps UTSW 11 83029129 unclassified noncoding transcript
R4293:Slfn10-ps UTSW 11 83035434 unclassified noncoding transcript
R4929:Slfn10-ps UTSW 11 83029519 unclassified noncoding transcript
R4970:Slfn10-ps UTSW 11 83030381 unclassified noncoding transcript
R5083:Slfn10-ps UTSW 11 83030515 unclassified noncoding transcript
R5290:Slfn10-ps UTSW 11 83029025 unclassified noncoding transcript
R5306:Slfn10-ps UTSW 11 83035529 unclassified noncoding transcript
R5444:Slfn10-ps UTSW 11 83035287 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCTGAGAACACTGCACAGCAGAAAG -3'
(R):5'- CAGGAGCCATGTATCAGAACAGCC -3'

Sequencing Primer
(F):5'- CAGCAGAAAGGCTCTACTTTG -3'
(R):5'- ATGTATCAGAACAGCCTTGAAAC -3'
Posted On 2013-11-08