Mutagenetix > Incidental Mutations

Incidental Mutation 'R0904:Slfn10-ps'

83259

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

039062-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R0904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83028130-83040042 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 83035409 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215473

Meta Mutation Damage Score

0.3555

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.2%
20x: 94.7%

Validation Efficiency

89% (34/38)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	G	8: 79,248,489		probably benign	Het
2810474O19Rik	G	A	6: 149,328,269	A938T	probably damaging	Het
9230110F15Rik	T	C	9: 35,839,070	D102G	probably damaging	Het
Abca13	T	C	11: 9,298,740	V2829A	probably benign	Het
Adk	G	T	14: 21,092,428	D26Y	probably damaging	Het
Bpifb9a	T	C	2: 154,264,225		probably benign	Het
Dap	G	A	15: 31,272,380		probably benign	Het
Eqtn	A	T	4: 94,907,655	S270T	probably benign	Het
Fam193a	A	G	5: 34,462,143	D764G	probably damaging	Het
Fbxl6	A	T	15: 76,537,083		probably null	Het
Gm13212	T	C	4: 145,622,175	Y61H	possibly damaging	Het
Gm3259	A	C	5: 95,341,327	T210P	probably damaging	Het
Gtf3c1	A	T	7: 125,668,842		probably benign	Het
H2-D1	G	C	17: 35,263,861	M122I	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map1s	C	A	8: 70,914,188	P579Q	probably damaging	Het
Mapk10	A	G	5: 102,987,280		probably benign	Het
Mllt6	C	G	11: 97,664,998	C51W	probably damaging	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Neurod2	G	T	11: 98,327,321	T339K	probably benign	Het
Nfya	G	A	17: 48,395,787	Q29*	probably null	Het
Nipbl	A	T	15: 8,361,718	D257E	probably benign	Het
Pex5	G	A	6: 124,399,937		probably benign	Het
Prx	T	A	7: 27,518,294	F879Y	probably damaging	Het
Scai	G	A	2: 39,075,152	T560M	possibly damaging	Het
Spdye4b	A	G	5: 143,195,668		probably benign	Het
Ss18l1	A	G	2: 180,059,354	Y287C	probably damaging	Het
Tpbg	C	A	9: 85,844,564	F195L	unknown	Het
Trbv16	T	C	6: 41,151,847		probably benign	Het
Unc5c	A	G	3: 141,803,840	T620A	probably benign	Het
Vangl1	A	G	3: 102,183,994	S259P	probably damaging	Het
Vmn1r52	T	A	6: 90,179,464	M71K	probably damaging	Het
Vmn2r23	A	T	6: 123,742,135	I816F	probably damaging	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	83035529	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	83035259	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	83035527	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	83035496	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	83035935	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	83029112	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	83032190	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	83029064	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	83032291	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	83030264	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	83030145	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	83030300	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	83030300	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	83035542	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	83035542	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	83035302	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	83035774	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	83029534	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	83035653	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	83035562	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	83029850	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	83030043	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	83030342	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	83035685	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	83028930	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	83029129	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	83035434	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	83029519	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	83030381	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	83030515	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	83029025	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	83035529	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	83035287	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TCTGAGAACACTGCACAGCAGAAAG -3'
(R):5'- CAGGAGCCATGTATCAGAACAGCC -3'

Sequencing Primer
(F):5'- CAGCAGAAAGGCTCTACTTTG -3'
(R):5'- ATGTATCAGAACAGCCTTGAAAC -3'

Posted On

2013-11-08