Incidental Mutation 'R0904:Neurod2'
ID 83261
Institutional Source Beutler Lab
Gene Symbol Neurod2
Ensembl Gene ENSMUSG00000038255
Gene Name neurogenic differentiation 2
Synonyms bHLHa1, Ndrf
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 98325415-98329648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 98327321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 339 (T339K)
Ref Sequence ENSEMBL: ENSMUSP00000041373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041685]
AlphaFold Q62414
Predicted Effect probably benign
Transcript: ENSMUST00000041685
AA Change: T339K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041373
Gene: ENSMUSG00000038255
AA Change: T339K

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 76 111 N/A INTRINSIC
HLH 128 180 4.19e-17 SMART
Pfam:Neuro_bHLH 181 311 5.7e-43 PFAM
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuroD family of neurogenic basic helix-loop-helix (bHLH) proteins. Expression of this gene can induce transcription from neuron-specific promoters, such as the GAP-43 promoter, which contain a specific DNA sequence known as an E-box. The product of the human gene can induce neurogenic differentiation in non-neuronal cells in Xenopus embryos, and is thought to play a role in the determination and maintenance of neuronal cell fates. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation show elevated neuronal apoptosis resulting in ataxia, incoordination, elevated seizure susceptibility, and death by 35 days. Heterozygotes are moderately affected, and adults are subject to unexplained death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Neurod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Neurod2 APN 11 98327769 missense probably damaging 1.00
IGL01751:Neurod2 APN 11 98327375 missense possibly damaging 0.94
IGL01752:Neurod2 APN 11 98327375 missense possibly damaging 0.94
IGL02661:Neurod2 APN 11 98327579 missense possibly damaging 0.65
hesitate UTSW 11 98327756 missense probably damaging 1.00
R5181_Neurod2_559 UTSW 11 98327378 missense probably benign 0.43
selection UTSW 11 98327321 missense probably benign 0.01
PIT4362001:Neurod2 UTSW 11 98327882 missense probably damaging 1.00
R0989:Neurod2 UTSW 11 98327979 missense probably damaging 1.00
R1290:Neurod2 UTSW 11 98327288 missense possibly damaging 0.69
R1564:Neurod2 UTSW 11 98327424 missense probably damaging 0.96
R1712:Neurod2 UTSW 11 98327203 missense probably damaging 1.00
R1901:Neurod2 UTSW 11 98327732 missense probably damaging 1.00
R2129:Neurod2 UTSW 11 98327588 missense possibly damaging 0.73
R2267:Neurod2 UTSW 11 98327756 missense probably damaging 1.00
R3754:Neurod2 UTSW 11 98327700 missense probably damaging 1.00
R4421:Neurod2 UTSW 11 98328200 nonsense probably null
R5067:Neurod2 UTSW 11 98327237 missense possibly damaging 0.71
R5181:Neurod2 UTSW 11 98327378 missense probably benign 0.43
R7922:Neurod2 UTSW 11 98327628 missense probably benign 0.00
R7976:Neurod2 UTSW 11 98327197 missense probably damaging 0.97
R8692:Neurod2 UTSW 11 98328134 missense probably benign 0.02
R8842:Neurod2 UTSW 11 98327681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGATGCTCTCCACGAGAGAAG -3'
(R):5'- CGGACTACAACAGCTCCGAGTACG -3'

Sequencing Primer
(F):5'- GGCCACCCACAGGTAAGAG -3'
(R):5'- AGTACGAGGGTCCACTCAGTC -3'
Posted On 2013-11-08