Incidental Mutation 'R0904:Adk'
ID 83262
Institutional Source Beutler Lab
Gene Symbol Adk
Ensembl Gene ENSMUSG00000039197
Gene Name adenosine kinase
Synonyms AK, 2310026J05Rik, 5033405D03Rik
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 21052574-21448569 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21092428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 26 (D26Y)
Ref Sequence ENSEMBL: ENSMUSP00000153089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045376] [ENSMUST00000223915] [ENSMUST00000224069] [ENSMUST00000224899]
AlphaFold P55264
Predicted Effect probably benign
Transcript: ENSMUST00000045376
AA Change: D42Y

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047665
Gene: ENSMUSG00000039197
AA Change: D42Y

DomainStartEndE-ValueType
Pfam:PfkB 41 359 1.1e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223861
Predicted Effect possibly damaging
Transcript: ENSMUST00000223915
AA Change: D40Y

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000224069
AA Change: D26Y

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224899
AA Change: D33Y

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225742
Meta Mutation Damage Score 0.6732 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in death before 14 days of age, growth retardation, liver abnormalities, apnea, and impaired temperature regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Adk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Adk APN 14 21092393 missense probably damaging 1.00
IGL01403:Adk APN 14 21234915 missense probably damaging 0.99
IGL01701:Adk APN 14 21103854 missense probably damaging 1.00
IGL02405:Adk APN 14 21103831 missense probably benign 0.06
IGL02808:Adk APN 14 21103833 missense probably benign 0.08
jeopardy UTSW 14 21234914 missense probably damaging 0.99
presumption UTSW 14 21240531 missense probably damaging 1.00
R0385:Adk UTSW 14 21318074 missense probably benign 0.01
R0463:Adk UTSW 14 21423536 missense probably benign 0.35
R1448:Adk UTSW 14 21052640 start codon destroyed probably null 0.00
R1695:Adk UTSW 14 21381600 missense probably benign 0.01
R2048:Adk UTSW 14 21318176 missense probably damaging 1.00
R4838:Adk UTSW 14 21369086 missense probably damaging 1.00
R5183:Adk UTSW 14 21240531 missense probably damaging 1.00
R5988:Adk UTSW 14 21423548 missense probably benign 0.03
R6770:Adk UTSW 14 21234914 missense probably damaging 0.99
R6932:Adk UTSW 14 21076308 start codon destroyed probably null 0.23
R7146:Adk UTSW 14 21326614 missense
R7257:Adk UTSW 14 21052671 missense probably damaging 0.99
R7491:Adk UTSW 14 21234929 missense probably damaging 0.96
R7806:Adk UTSW 14 21326611 missense
R7922:Adk UTSW 14 21318043 missense probably benign
R8465:Adk UTSW 14 21103824 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTCTGATGTGCAACTGGCAAATCAAAG -3'
(R):5'- TTCCCTCCAACTGAGGGTGATATATGG -3'

Sequencing Primer
(F):5'- GCAACTGGCAAATCAAAGGTTTAATC -3'
(R):5'- gcaagaattacttttctccttctacc -3'
Posted On 2013-11-08