Incidental Mutation 'R0904:Nipbl'
ID 83263
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4921518A06Rik, 4933421G18Rik
MMRRC Submission 039062-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 8290617-8444463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8361718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 257 (D257E)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000052965
AA Change: D257E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: D257E

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 (GRCm38) probably benign Het
2810474O19Rik G A 6: 149,328,269 (GRCm38) A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 (GRCm38) D102G probably damaging Het
Abca13 T C 11: 9,298,740 (GRCm38) V2829A probably benign Het
Adk G T 14: 21,092,428 (GRCm38) D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 (GRCm38) probably benign Het
Dap G A 15: 31,272,380 (GRCm38) probably benign Het
Eqtn A T 4: 94,907,655 (GRCm38) S270T probably benign Het
Fam193a A G 5: 34,462,143 (GRCm38) D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 (GRCm38) probably null Het
Gm13212 T C 4: 145,622,175 (GRCm38) Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 (GRCm38) T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 (GRCm38) probably benign Het
H2-D1 G C 17: 35,263,861 (GRCm38) M122I probably benign Het
Lgr6 C T 1: 134,994,010 (GRCm38) A199T probably damaging Het
Map1s C A 8: 70,914,188 (GRCm38) P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 (GRCm38) probably benign Het
Mllt6 C G 11: 97,664,998 (GRCm38) C51W probably damaging Het
Mzf1 C A 7: 13,052,771 (GRCm38) R124L possibly damaging Het
Naip2 T C 13: 100,161,854 (GRCm38) E558G probably benign Het
Naip2 C T 13: 100,161,860 (GRCm38) G556D probably benign Het
Neurod2 G T 11: 98,327,321 (GRCm38) T339K probably benign Het
Nfya G A 17: 48,395,787 (GRCm38) Q29* probably null Het
Pex5 G A 6: 124,399,937 (GRCm38) probably benign Het
Prx T A 7: 27,518,294 (GRCm38) F879Y probably damaging Het
Scai G A 2: 39,075,152 (GRCm38) T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 (GRCm38) noncoding transcript Het
Spdye4b A G 5: 143,195,668 (GRCm38) probably benign Het
Ss18l1 A G 2: 180,059,354 (GRCm38) Y287C probably damaging Het
Tpbg C A 9: 85,844,564 (GRCm38) F195L unknown Het
Trbv16 T C 6: 41,151,847 (GRCm38) probably benign Het
Unc5c A G 3: 141,803,840 (GRCm38) T620A probably benign Het
Vangl1 A G 3: 102,183,994 (GRCm38) S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 (GRCm38) M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 (GRCm38) I816F probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8,366,673 (GRCm38) missense probably damaging 0.98
IGL00712:Nipbl APN 15 8,369,474 (GRCm38) missense probably damaging 0.97
IGL00789:Nipbl APN 15 8,296,869 (GRCm38) missense probably damaging 1.00
IGL01025:Nipbl APN 15 8,350,455 (GRCm38) missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8,350,497 (GRCm38) missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8,311,209 (GRCm38) missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8,350,539 (GRCm38) missense probably benign
IGL01723:Nipbl APN 15 8,335,071 (GRCm38) missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8,361,821 (GRCm38) missense probably benign 0.13
IGL02398:Nipbl APN 15 8,327,090 (GRCm38) missense probably damaging 1.00
IGL02437:Nipbl APN 15 8,359,074 (GRCm38) missense probably damaging 1.00
IGL02450:Nipbl APN 15 8,343,574 (GRCm38) missense probably damaging 0.99
IGL02477:Nipbl APN 15 8,323,647 (GRCm38) splice site probably null
IGL02547:Nipbl APN 15 8,351,598 (GRCm38) missense probably benign
IGL02678:Nipbl APN 15 8,351,110 (GRCm38) missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8,295,553 (GRCm38) missense probably benign 0.34
IGL03003:Nipbl APN 15 8,350,314 (GRCm38) missense probably damaging 1.00
IGL03117:Nipbl APN 15 8,332,452 (GRCm38) missense probably damaging 1.00
IGL03162:Nipbl APN 15 8,338,979 (GRCm38) missense probably benign 0.37
IGL03224:Nipbl APN 15 8,293,085 (GRCm38) missense probably damaging 0.98
IGL03339:Nipbl APN 15 8,350,876 (GRCm38) missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8,360,956 (GRCm38) missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8,350,732 (GRCm38) missense probably benign
R3620_nipbl_616 UTSW 15 8,333,024 (GRCm38) missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8,300,784 (GRCm38) missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8,293,115 (GRCm38) missense probably benign 0.00
R0271:Nipbl UTSW 15 8,361,737 (GRCm38) missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8,360,956 (GRCm38) missense probably damaging 0.99
R0347:Nipbl UTSW 15 8,350,732 (GRCm38) missense probably benign
R0422:Nipbl UTSW 15 8,351,628 (GRCm38) missense probably benign
R0486:Nipbl UTSW 15 8,338,870 (GRCm38) splice site probably benign
R0652:Nipbl UTSW 15 8,303,480 (GRCm38) missense probably benign 0.23
R0667:Nipbl UTSW 15 8,361,004 (GRCm38) missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8,293,078 (GRCm38) splice site probably null
R0726:Nipbl UTSW 15 8,351,555 (GRCm38) missense probably benign
R0881:Nipbl UTSW 15 8,307,612 (GRCm38) missense probably damaging 0.98
R0969:Nipbl UTSW 15 8,292,228 (GRCm38) missense probably damaging 1.00
R1401:Nipbl UTSW 15 8,372,173 (GRCm38) missense probably damaging 0.97
R1479:Nipbl UTSW 15 8,350,289 (GRCm38) missense probably benign 0.00
R1495:Nipbl UTSW 15 8,351,280 (GRCm38) missense probably benign 0.00
R1609:Nipbl UTSW 15 8,366,664 (GRCm38) missense probably damaging 1.00
R1679:Nipbl UTSW 15 8,302,912 (GRCm38) missense probably benign 0.31
R1756:Nipbl UTSW 15 8,338,551 (GRCm38) missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8,319,488 (GRCm38) missense probably damaging 1.00
R1835:Nipbl UTSW 15 8,343,517 (GRCm38) missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8,327,132 (GRCm38) missense probably damaging 1.00
R1914:Nipbl UTSW 15 8,343,630 (GRCm38) missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8,343,630 (GRCm38) missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8,350,287 (GRCm38) missense probably damaging 1.00
R2046:Nipbl UTSW 15 8,324,467 (GRCm38) missense probably benign 0.08
R2076:Nipbl UTSW 15 8,311,207 (GRCm38) missense probably benign 0.11
R2163:Nipbl UTSW 15 8,336,919 (GRCm38) missense probably damaging 0.99
R2170:Nipbl UTSW 15 8,293,218 (GRCm38) missense probably damaging 1.00
R2425:Nipbl UTSW 15 8,351,482 (GRCm38) missense probably benign 0.06
R2475:Nipbl UTSW 15 8,335,006 (GRCm38) missense probably benign 0.05
R2484:Nipbl UTSW 15 8,323,698 (GRCm38) missense probably damaging 0.99
R2970:Nipbl UTSW 15 8,311,239 (GRCm38) missense probably damaging 1.00
R3116:Nipbl UTSW 15 8,343,592 (GRCm38) missense probably benign 0.00
R3620:Nipbl UTSW 15 8,333,024 (GRCm38) missense probably damaging 0.99
R3725:Nipbl UTSW 15 8,295,661 (GRCm38) missense probably damaging 0.97
R3745:Nipbl UTSW 15 8,358,874 (GRCm38) missense probably benign
R3902:Nipbl UTSW 15 8,350,246 (GRCm38) missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8,350,534 (GRCm38) missense probably benign
R4164:Nipbl UTSW 15 8,338,934 (GRCm38) missense probably benign 0.24
R4246:Nipbl UTSW 15 8,332,432 (GRCm38) missense probably damaging 1.00
R4381:Nipbl UTSW 15 8,359,206 (GRCm38) missense probably benign 0.00
R4394:Nipbl UTSW 15 8,361,861 (GRCm38) missense probably benign 0.00
R4439:Nipbl UTSW 15 8,338,724 (GRCm38) missense probably damaging 0.98
R4440:Nipbl UTSW 15 8,366,658 (GRCm38) missense probably damaging 0.98
R4441:Nipbl UTSW 15 8,366,658 (GRCm38) missense probably damaging 0.98
R4672:Nipbl UTSW 15 8,302,984 (GRCm38) missense probably damaging 1.00
R4749:Nipbl UTSW 15 8,365,829 (GRCm38) missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8,351,497 (GRCm38) missense probably benign
R5428:Nipbl UTSW 15 8,330,296 (GRCm38) missense probably benign 0.00
R5641:Nipbl UTSW 15 8,366,712 (GRCm38) missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8,358,907 (GRCm38) missense probably benign
R5644:Nipbl UTSW 15 8,358,907 (GRCm38) missense probably benign
R5681:Nipbl UTSW 15 8,301,382 (GRCm38) missense probably benign 0.22
R5741:Nipbl UTSW 15 8,324,649 (GRCm38) missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8,334,844 (GRCm38) splice site probably null
R5970:Nipbl UTSW 15 8,296,818 (GRCm38) missense probably benign 0.27
R6041:Nipbl UTSW 15 8,324,264 (GRCm38) missense probably damaging 1.00
R6059:Nipbl UTSW 15 8,295,568 (GRCm38) missense probably damaging 1.00
R6213:Nipbl UTSW 15 8,334,906 (GRCm38) missense probably damaging 1.00
R6216:Nipbl UTSW 15 8,318,383 (GRCm38) missense probably damaging 0.99
R6236:Nipbl UTSW 15 8,324,580 (GRCm38) missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8,300,895 (GRCm38) missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8,300,895 (GRCm38) missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8,300,784 (GRCm38) missense probably damaging 0.99
R6427:Nipbl UTSW 15 8,351,565 (GRCm38) missense probably benign
R6707:Nipbl UTSW 15 8,324,559 (GRCm38) missense probably benign 0.01
R6731:Nipbl UTSW 15 8,322,590 (GRCm38) missense probably damaging 1.00
R6921:Nipbl UTSW 15 8,303,485 (GRCm38) missense probably benign 0.28
R7239:Nipbl UTSW 15 8,292,135 (GRCm38) critical splice donor site probably null
R7346:Nipbl UTSW 15 8,343,606 (GRCm38) missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8,330,295 (GRCm38) missense probably benign 0.01
R7486:Nipbl UTSW 15 8,295,636 (GRCm38) missense probably benign 0.25
R7598:Nipbl UTSW 15 8,343,493 (GRCm38) missense probably benign 0.24
R7609:Nipbl UTSW 15 8,305,872 (GRCm38) missense probably benign 0.27
R7674:Nipbl UTSW 15 8,293,101 (GRCm38) missense probably benign 0.15
R7706:Nipbl UTSW 15 8,351,526 (GRCm38) missense probably benign 0.01
R7760:Nipbl UTSW 15 8,358,702 (GRCm38) missense probably damaging 1.00
R7766:Nipbl UTSW 15 8,296,849 (GRCm38) missense probably benign 0.45
R7825:Nipbl UTSW 15 8,291,487 (GRCm38) missense probably damaging 1.00
R7862:Nipbl UTSW 15 8,325,752 (GRCm38) missense probably benign 0.06
R7958:Nipbl UTSW 15 8,311,258 (GRCm38) missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8,311,250 (GRCm38) missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8,359,212 (GRCm38) missense probably benign 0.22
R8355:Nipbl UTSW 15 8,335,044 (GRCm38) missense probably damaging 0.98
R8441:Nipbl UTSW 15 8,293,115 (GRCm38) missense probably benign 0.00
R8455:Nipbl UTSW 15 8,335,044 (GRCm38) missense probably damaging 0.98
R8717:Nipbl UTSW 15 8,338,741 (GRCm38) missense probably benign
R8739:Nipbl UTSW 15 8,303,420 (GRCm38) missense probably benign 0.08
R8854:Nipbl UTSW 15 8,300,726 (GRCm38) missense probably damaging 1.00
R8887:Nipbl UTSW 15 8,361,787 (GRCm38) missense probably damaging 1.00
R8942:Nipbl UTSW 15 8,351,620 (GRCm38) missense probably benign
R8991:Nipbl UTSW 15 8,291,513 (GRCm38) missense probably damaging 1.00
R9008:Nipbl UTSW 15 8,327,124 (GRCm38) missense probably damaging 1.00
R9070:Nipbl UTSW 15 8,338,731 (GRCm38) missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8,350,856 (GRCm38) missense probably benign 0.00
R9622:Nipbl UTSW 15 8,336,889 (GRCm38) missense probably benign 0.27
R9778:Nipbl UTSW 15 8,291,548 (GRCm38) missense probably benign 0.10
RF020:Nipbl UTSW 15 8,358,934 (GRCm38) missense probably damaging 0.98
X0022:Nipbl UTSW 15 8,351,715 (GRCm38) missense probably benign 0.05
X0027:Nipbl UTSW 15 8,323,537 (GRCm38) missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8,307,882 (GRCm38) missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8,338,699 (GRCm38) missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8,338,680 (GRCm38) critical splice donor site probably null
Z1177:Nipbl UTSW 15 8,336,952 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAATTTCAATAAAAGTGCCGTGAC -3'
(R):5'- CAGTGACATCCATCACAGTATCGGG -3'

Sequencing Primer
(F):5'- ACTGAAATTCAACCCTGCTCTATG -3'
(R):5'- gtagcccatgctggcttc -3'
Posted On 2013-11-08