Incidental Mutation 'R0904:Fbxl6'
ID 83265
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene Name F-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76535721-76538746 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 76537083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000023220] [ENSMUST00000230604]
AlphaFold Q9QXW0
Predicted Effect probably benign
Transcript: ENSMUST00000023219
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230513
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230994
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76535906 nonsense probably null
IGL02205:Fbxl6 APN 15 76537341 missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76537191 missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76535955 missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76536753 missense probably benign 0.04
R1477:Fbxl6 UTSW 15 76537734 missense probably benign
R1784:Fbxl6 UTSW 15 76538058 missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76536973 missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76536624 nonsense probably null
R4414:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4416:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4483:Fbxl6 UTSW 15 76537929 missense probably damaging 1.00
R4835:Fbxl6 UTSW 15 76536804 missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76538433 missense probably benign
R6345:Fbxl6 UTSW 15 76535854 missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76538412 missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76538698 unclassified probably benign
R7485:Fbxl6 UTSW 15 76537913 splice site probably null
R7560:Fbxl6 UTSW 15 76538469 missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76535886 missense probably damaging 1.00
R7811:Fbxl6 UTSW 15 76537285 splice site probably null
R8353:Fbxl6 UTSW 15 76538478 missense probably benign 0.06
R8548:Fbxl6 UTSW 15 76537342 missense possibly damaging 0.65
X0058:Fbxl6 UTSW 15 76538476 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGAAGCCAAATCAGATTCAGCAGCC -3'
(R):5'- GCTTTCAGACTGCCACACTGTGAC -3'

Sequencing Primer
(F):5'- GATTCAGCAGCCGCAGC -3'
(R):5'- ACTGTGACTGCTGAAACTCTG -3'
Posted On 2013-11-08