Incidental Mutation 'R0904:H2-D1'
ID 83266
Institutional Source Beutler Lab
Gene Symbol H2-D1
Ensembl Gene ENSMUSG00000073411
Gene Name histocompatibility 2, D region locus 1
Synonyms H-2D
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 35262730-35267499 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 35263861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 122 (M122I)
Ref Sequence ENSEMBL: ENSMUSP00000134570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172785]
AlphaFold no structure available at present
PDB Structure CRYSTAL STRUCTURE OF MURINE CLASS I MHC H2-DB COMPLEXED WITH A SYNTHETIC PEPTIDE P1027 [X-RAY DIFFRACTION]
MHC CLASS I H-2DB COMPLEXED WITH A SENDAI VIRUS NUCLEOPROTEIN PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH PEPTIDE GP33(C9M) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH SYNTHETIC PEPTIDE GP33 (C9M/K1A) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH PEPTIDE GP33 (C9M/K1S) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LCMV PEPTIDIC EPITOPE GP33 IN COMPLEX WITH THE MURINE CLASS I MHC MOLECULE H-2DB [X-RAY DIFFRACTION]
THE THREE-DIMENSIONAL STRUCTURE OF H-2DB AT 2.4 ANGSTROMS RESOLUTION: IMPLICATIONS FOR ANTIGEN-DETERMINANT SELECTION [X-RAY DIFFRACTION]
Structure of Minor Histocompatibility Antigen peptide, H13a, complexed to H2-Db [X-RAY DIFFRACTION]
Crystal Structure Of The LCMV Peptidic Epitope Gp276 In Complex With The Murine Class I Mhc Molecule H-2Db [X-RAY DIFFRACTION]
Crystal Structure Of The LCMV Peptidic Epitope Np396 In Complex With The Murine Class I Mhc Molecule H-2Db [X-RAY DIFFRACTION]
>> 46 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000172503
SMART Domains Protein: ENSMUSP00000134582
Gene: ENSMUSG00000073411

DomainStartEndE-ValueType
SCOP:d1hdma1 2 21 3e-8 SMART
Pfam:MHC_I_C 57 81 1.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172785
AA Change: M122I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134570
Gene: ENSMUSG00000073411
AA Change: M122I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 25 203 8.3e-93 PFAM
IGc1 222 293 4.73e-23 SMART
transmembrane domain 308 330 N/A INTRINSIC
Pfam:MHC_I_C 337 361 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173167
SMART Domains Protein: ENSMUSP00000133518
Gene: ENSMUSG00000073411

DomainStartEndE-ValueType
SCOP:d1hdma1 2 21 3e-8 SMART
Pfam:MHC_I_C 52 76 1.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174325
Meta Mutation Damage Score 0.4727 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele are susceptible to chronic Theiler's Murine Encephalomyelitis Virus (TMEV) infection and demyelination, and lack the ability to respond to the viral peptide VP2121-130, the single Ag driving the protective CD8 T cell response in wild-type B6 mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nfya G A 17: 48,395,787 Q29* probably null Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in H2-D1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02193:H2-D1 APN 17 35265809 missense possibly damaging 0.91
IGL02207:H2-D1 APN 17 35263414 missense possibly damaging 0.94
IGL02949:H2-D1 APN 17 35264088 missense probably benign 0.02
Ancillum UTSW 17 35263511 missense probably damaging 0.98
subaltern UTSW 17 35263937 missense probably damaging 0.99
R0627:H2-D1 UTSW 17 35265922 missense probably damaging 1.00
R1238:H2-D1 UTSW 17 35263932 missense probably damaging 1.00
R1500:H2-D1 UTSW 17 35263588 missense probably benign 0.01
R1508:H2-D1 UTSW 17 35263868 missense probably damaging 1.00
R1627:H2-D1 UTSW 17 35263495 missense possibly damaging 0.79
R1730:H2-D1 UTSW 17 35263405 missense probably damaging 1.00
R1804:H2-D1 UTSW 17 35263552 missense probably damaging 1.00
R1964:H2-D1 UTSW 17 35263619 missense probably benign 0.06
R2125:H2-D1 UTSW 17 35264115 critical splice donor site probably null
R4652:H2-D1 UTSW 17 35266516 critical splice donor site probably null
R4911:H2-D1 UTSW 17 35265997 missense probably damaging 1.00
R4965:H2-D1 UTSW 17 35263905 missense probably damaging 1.00
R5423:H2-D1 UTSW 17 35265907 missense probably damaging 1.00
R6109:H2-D1 UTSW 17 35263937 missense probably damaging 0.99
R7525:H2-D1 UTSW 17 35265933 missense probably damaging 1.00
R7697:H2-D1 UTSW 17 35263145 missense probably damaging 1.00
R7832:H2-D1 UTSW 17 35263872 missense probably damaging 0.99
R7903:H2-D1 UTSW 17 35263991 missense probably damaging 0.99
R8004:H2-D1 UTSW 17 35266696 missense probably benign 0.00
R8167:H2-D1 UTSW 17 35266765 missense
R8465:H2-D1 UTSW 17 35263511 missense probably damaging 0.98
R8786:H2-D1 UTSW 17 35263868 missense probably damaging 1.00
R9188:H2-D1 UTSW 17 35265802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGGCTATGTGGACAACAAGG -3'
(R):5'- AGGGTTTCTTCTTCCCCAGGACTG -3'

Sequencing Primer
(F):5'- GAACCTGCTCGGCTACTAC -3'
(R):5'- GGTATCTGTGGAGCCACTC -3'
Posted On 2013-11-08