Incidental Mutation 'R0904:Nfya'
ID 83267
Institutional Source Beutler Lab
Gene Symbol Nfya
Ensembl Gene ENSMUSG00000023994
Gene Name nuclear transcription factor-Y alpha
Synonyms Sez10, Cbf-b
MMRRC Submission 039062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0904 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 48386885-48409906 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 48395787 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 29 (Q29*)
Ref Sequence ENSEMBL: ENSMUSP00000123785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046719] [ENSMUST00000078800] [ENSMUST00000159063] [ENSMUST00000159535] [ENSMUST00000160319] [ENSMUST00000161117] [ENSMUST00000161256] [ENSMUST00000162460]
AlphaFold P23708
Predicted Effect probably null
Transcript: ENSMUST00000046719
AA Change: Q58*
SMART Domains Protein: ENSMUSP00000043909
Gene: ENSMUSG00000023994
AA Change: Q58*

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 205 223 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
CBF 260 321 3.92e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078800
AA Change: Q57*
SMART Domains Protein: ENSMUSP00000077853
Gene: ENSMUSG00000023994
AA Change: Q57*

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 57 N/A INTRINSIC
low complexity region 98 166 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
CBF 259 320 3.92e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159063
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000124404
Gene: ENSMUSG00000023994
AA Change: Q29*

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
CBF 225 286 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159237
SMART Domains Protein: ENSMUSP00000124115
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 66 84 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
CBF 121 182 3.92e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159535
AA Change: Q56*
SMART Domains Protein: ENSMUSP00000124501
Gene: ENSMUSG00000023994
AA Change: Q56*

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
internal_repeat_1 57 82 3.82e-6 PROSPERO
internal_repeat_1 74 95 3.82e-6 PROSPERO
low complexity region 97 165 N/A INTRINSIC
low complexity region 197 215 N/A INTRINSIC
low complexity region 218 232 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160319
AA Change: Q58*
SMART Domains Protein: ENSMUSP00000124245
Gene: ENSMUSG00000023994
AA Change: Q58*

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
low complexity region 220 234 N/A INTRINSIC
CBF 254 315 3.92e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160804
Predicted Effect probably null
Transcript: ENSMUST00000161117
AA Change: Q23*
SMART Domains Protein: ENSMUSP00000124965
Gene: ENSMUSG00000023994
AA Change: Q23*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
internal_repeat_1 24 49 2.33e-5 PROSPERO
internal_repeat_1 41 62 2.33e-5 PROSPERO
low complexity region 64 132 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161256
SMART Domains Protein: ENSMUSP00000125034
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 1 33 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
CBF 124 185 9.8e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161686
Predicted Effect probably null
Transcript: ENSMUST00000162460
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000123785
Gene: ENSMUSG00000023994
AA Change: Q29*

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
CBF 231 292 3.92e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163066
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus impairs development and results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,248,489 probably benign Het
2810474O19Rik G A 6: 149,328,269 A938T probably damaging Het
9230110F15Rik T C 9: 35,839,070 D102G probably damaging Het
Abca13 T C 11: 9,298,740 V2829A probably benign Het
Adk G T 14: 21,092,428 D26Y probably damaging Het
Bpifb9a T C 2: 154,264,225 probably benign Het
Dap G A 15: 31,272,380 probably benign Het
Eqtn A T 4: 94,907,655 S270T probably benign Het
Fam193a A G 5: 34,462,143 D764G probably damaging Het
Fbxl6 A T 15: 76,537,083 probably null Het
Gm13212 T C 4: 145,622,175 Y61H possibly damaging Het
Gm3259 A C 5: 95,341,327 T210P probably damaging Het
Gtf3c1 A T 7: 125,668,842 probably benign Het
H2-D1 G C 17: 35,263,861 M122I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map1s C A 8: 70,914,188 P579Q probably damaging Het
Mapk10 A G 5: 102,987,280 probably benign Het
Mllt6 C G 11: 97,664,998 C51W probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Neurod2 G T 11: 98,327,321 T339K probably benign Het
Nipbl A T 15: 8,361,718 D257E probably benign Het
Pex5 G A 6: 124,399,937 probably benign Het
Prx T A 7: 27,518,294 F879Y probably damaging Het
Scai G A 2: 39,075,152 T560M possibly damaging Het
Slfn10-ps T C 11: 83,035,409 noncoding transcript Het
Spdye4b A G 5: 143,195,668 probably benign Het
Ss18l1 A G 2: 180,059,354 Y287C probably damaging Het
Tpbg C A 9: 85,844,564 F195L unknown Het
Trbv16 T C 6: 41,151,847 probably benign Het
Unc5c A G 3: 141,803,840 T620A probably benign Het
Vangl1 A G 3: 102,183,994 S259P probably damaging Het
Vmn1r52 T A 6: 90,179,464 M71K probably damaging Het
Vmn2r23 A T 6: 123,742,135 I816F probably damaging Het
Other mutations in Nfya
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Nfya APN 17 48393255 unclassified probably benign
IGL02348:Nfya APN 17 48393276 nonsense probably null
IGL03220:Nfya APN 17 48400493 missense possibly damaging 0.66
IGL03274:Nfya APN 17 48391347 missense probably damaging 1.00
PIT4468001:Nfya UTSW 17 48395777 missense unknown
R0147:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0148:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R1484:Nfya UTSW 17 48393542 unclassified probably benign
R4105:Nfya UTSW 17 48392884 nonsense probably null
R4108:Nfya UTSW 17 48392884 nonsense probably null
R4109:Nfya UTSW 17 48392884 nonsense probably null
R4923:Nfya UTSW 17 48400535 utr 5 prime probably benign
R5411:Nfya UTSW 17 48392018 missense possibly damaging 0.83
R6299:Nfya UTSW 17 48392910 intron probably benign
R6846:Nfya UTSW 17 48395687 missense probably benign 0.04
R6967:Nfya UTSW 17 48392904 intron probably benign
R7027:Nfya UTSW 17 48389312 missense probably benign 0.00
R7634:Nfya UTSW 17 48392417 missense probably damaging 0.99
R8377:Nfya UTSW 17 48392045 missense possibly damaging 0.92
R8460:Nfya UTSW 17 48391946 missense possibly damaging 0.70
R8501:Nfya UTSW 17 48398989 missense unknown
R8726:Nfya UTSW 17 48392417 missense probably damaging 0.99
R8935:Nfya UTSW 17 48393266 unclassified probably benign
R8950:Nfya UTSW 17 48393461 unclassified probably benign
R9252:Nfya UTSW 17 48392915 missense
R9321:Nfya UTSW 17 48400466 missense unknown
Z1177:Nfya UTSW 17 48393513 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCTCACCTGCTGTAAACCTTG -3'
(R):5'- ACCTTTGACTATCCAGCTTGGCAC -3'

Sequencing Primer
(F):5'- GCTGTAAACCTTGTGTTCCAGAC -3'
(R):5'- ttgggaggcagagggag -3'
Posted On 2013-11-08