Incidental Mutation 'R0905:Itih5'
ID 83272
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission 039063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R0905 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 10249188 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 750 (R750Q)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: R750Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: R750Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,849,934 T1539M possibly damaging Het
Birc3 A T 9: 7,851,051 *138R probably null Het
Bsn C A 9: 108,105,635 D3640Y unknown Het
Bsph1 A T 7: 13,450,914 M1L probably benign Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Cfap74 G A 4: 155,418,696 probably null Het
Crtc1 A T 8: 70,391,255 S454T probably damaging Het
Cspg5 A T 9: 110,246,526 D110V probably damaging Het
Cyp2w1 A T 5: 139,356,439 Y380F probably benign Het
Dbn1 T C 13: 55,474,227 probably benign Het
Epb41l4b T C 4: 57,103,528 K103E probably damaging Het
Eps8 C T 6: 137,514,307 V358I probably benign Het
Gm12253 G T 11: 58,440,020 probably benign Het
Hltf T A 3: 20,108,869 probably null Het
Hsd17b11 C T 5: 104,009,878 V123I probably benign Het
Il31ra T A 13: 112,531,673 E481V probably damaging Het
Impdh2 A G 9: 108,561,097 probably benign Het
Kndc1 A C 7: 139,923,735 K985T possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lgsn A T 1: 31,203,743 Y302F probably damaging Het
Lrp1b A G 2: 41,284,185 S1541P probably damaging Het
Mast4 A G 13: 102,770,784 M528T probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndufs2 T C 1: 171,236,353 probably null Het
Nwd1 G A 8: 72,709,449 V1436M probably damaging Het
Phf12 C T 11: 78,009,404 R109* probably null Het
Pml A G 9: 58,249,539 probably null Het
Ppfia2 T C 10: 106,819,511 I313T probably benign Het
Prdm14 C T 1: 13,125,438 G133D probably benign Het
Pygl A G 12: 70,211,017 probably benign Het
Rassf10 C T 7: 112,955,368 T392M probably damaging Het
Rpe65 T C 3: 159,601,583 S54P possibly damaging Het
Sema5b T C 16: 35,622,631 V2A probably benign Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Spn T C 7: 127,136,331 T335A probably damaging Het
Tecta T C 9: 42,338,994 D1834G probably damaging Het
Trp53bp1 C A 2: 121,204,318 probably benign Het
Ttc3 A T 16: 94,456,789 K1652* probably null Het
Zadh2 A G 18: 84,095,207 H336R probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
R9744:Itih5 UTSW 2 10251410 missense probably damaging 1.00
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCAGAGAAACAGTATGGCTGCCAC -3'
(R):5'- AATGTTGCCCTGGATGACCACG -3'

Sequencing Primer
(F):5'- ccacccaacctcctactttc -3'
(R):5'- CTGGATGACCACGGTGATG -3'
Posted On 2013-11-08