Mutagenetix > Incidental Mutation

Incidental Mutation 'R0905:Nwd1'

83290

Institutional Source

Beutler Lab

Gene Symbol

Nwd1

Ensembl Gene

ENSMUSG00000048148

Gene Name

NACHT and WD repeat domain containing 1

Synonyms

A230063L24Rik

MMRRC Submission

039063-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R0905 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

73372865-73443508 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73436077 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1436 (V1436M)

Ref Sequence

ENSEMBL: ENSMUSP00000091135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]

AlphaFold

A6H603

Predicted Effect

probably damaging
Transcript: ENSMUST00000093427
AA Change: V1436M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: V1436M

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
Pfam:AAA_16	312	457	7.3e-8	PFAM
Pfam:NACHT	336	511	1.3e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	985	2e-15	BLAST
WD40	988	1028	2.05e1	SMART
Blast:WD40	1037	1073	2e-9	BLAST
Blast:WD40	1073	1110	4e-10	BLAST
WD40	1118	1156	5.97e-1	SMART
WD40	1160	1198	6.6e1	SMART
WD40	1245	1283	5.3e1	SMART
WD40	1286	1326	2.13e1	SMART
WD40	1340	1375	1.06e2	SMART
WD40	1377	1416	3.5e-4	SMART
WD40	1421	1461	2.66e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160443

SMART Domains

Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160912

Predicted Effect

probably damaging
Transcript: ENSMUST00000161254
AA Change: V1394M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: V1394M

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
Pfam:NACHT	336	511	2.1e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	985	1e-15	BLAST
WD40	988	1028	2.05e1	SMART
Blast:WD40	1037	1073	2e-9	BLAST
Blast:WD40	1073	1110	3e-10	BLAST
WD40	1118	1156	2.49e-1	SMART
WD40	1203	1241	5.3e1	SMART
WD40	1244	1284	2.13e1	SMART
WD40	1298	1333	1.06e2	SMART
WD40	1335	1374	3.5e-4	SMART
WD40	1379	1419	2.66e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161557

SMART Domains

Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163026

Predicted Effect

probably damaging
Transcript: ENSMUST00000228312
AA Change: V1435M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.6%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap21	G	A	2: 20,854,745 (GRCm39)	T1539M	possibly damaging	Het
Birc2	A	T	9: 7,851,052 (GRCm39)	*138R	probably null	Het
Bsn	C	A	9: 107,982,834 (GRCm39)	D3640Y	unknown	Het
Bsph1	A	T	7: 13,184,839 (GRCm39)	M1L	probably benign	Het
Cdkl1	A	T	12: 69,803,338 (GRCm39)	Y179*	probably null	Het
Cfap74	G	A	4: 155,503,153 (GRCm39)		probably null	Het
Crtc1	A	T	8: 70,843,905 (GRCm39)	S454T	probably damaging	Het
Cspg5	A	T	9: 110,075,594 (GRCm39)	D110V	probably damaging	Het
Cyp2w1	A	T	5: 139,342,194 (GRCm39)	Y380F	probably benign	Het
Dbn1	T	C	13: 55,622,040 (GRCm39)		probably benign	Het
Epb41l4b	T	C	4: 57,103,528 (GRCm39)	K103E	probably damaging	Het
Eps8	C	T	6: 137,491,305 (GRCm39)	V358I	probably benign	Het
Gm12253	G	T	11: 58,330,846 (GRCm39)		probably benign	Het
Hltf	T	A	3: 20,163,033 (GRCm39)		probably null	Het
Hsd17b11	C	T	5: 104,157,744 (GRCm39)	V123I	probably benign	Het
Il31ra	T	A	13: 112,668,207 (GRCm39)	E481V	probably damaging	Het
Impdh2	A	G	9: 108,438,296 (GRCm39)		probably benign	Het
Itih5	G	A	2: 10,253,999 (GRCm39)	R750Q	probably benign	Het
Kndc1	A	C	7: 139,503,651 (GRCm39)	K985T	possibly damaging	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Lgsn	A	T	1: 31,242,824 (GRCm39)	Y302F	probably damaging	Het
Lrp1b	A	G	2: 41,174,197 (GRCm39)	S1541P	probably damaging	Het
Mast4	A	G	13: 102,907,292 (GRCm39)	M528T	probably damaging	Het
Mzf1	C	A	7: 12,786,698 (GRCm39)	R124L	possibly damaging	Het
Ndufs2	T	C	1: 171,063,922 (GRCm39)		probably null	Het
Phf12	C	T	11: 77,900,230 (GRCm39)	R109*	probably null	Het
Pml	A	G	9: 58,156,822 (GRCm39)		probably null	Het
Ppfia2	T	C	10: 106,655,372 (GRCm39)	I313T	probably benign	Het
Prdm14	C	T	1: 13,195,662 (GRCm39)	G133D	probably benign	Het
Ptgr3	A	G	18: 84,113,332 (GRCm39)	H336R	probably benign	Het
Pygl	A	G	12: 70,257,791 (GRCm39)		probably benign	Het
Rassf10	C	T	7: 112,554,575 (GRCm39)	T392M	probably damaging	Het
Rpe65	T	C	3: 159,307,220 (GRCm39)	S54P	possibly damaging	Het
Sema5b	T	C	16: 35,443,001 (GRCm39)	V2A	probably benign	Het
Sgsm3	T	C	15: 80,895,546 (GRCm39)	I699T	probably damaging	Het
Spn	T	C	7: 126,735,503 (GRCm39)	T335A	probably damaging	Het
Tecta	T	C	9: 42,250,290 (GRCm39)	D1834G	probably damaging	Het
Trp53bp1	C	A	2: 121,034,799 (GRCm39)		probably benign	Het
Ttc3	A	T	16: 94,257,648 (GRCm39)	K1652*	probably null	Het

Other mutations in Nwd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Nwd1	APN	8	73,397,705 (GRCm39)	missense	probably damaging	0.99
IGL01294:Nwd1	APN	8	73,438,373 (GRCm39)	missense	probably damaging	1.00
IGL01298:Nwd1	APN	8	73,388,959 (GRCm39)	missense	probably benign	0.00
IGL01333:Nwd1	APN	8	73,393,439 (GRCm39)	missense	possibly damaging	0.90
IGL01371:Nwd1	APN	8	73,401,743 (GRCm39)	missense	probably damaging	1.00
IGL02244:Nwd1	APN	8	73,434,210 (GRCm39)	missense	probably damaging	1.00
IGL02579:Nwd1	APN	8	73,434,155 (GRCm39)	missense	probably damaging	1.00
IGL02608:Nwd1	APN	8	73,394,003 (GRCm39)	missense	probably damaging	1.00
IGL02632:Nwd1	APN	8	73,394,082 (GRCm39)	missense	possibly damaging	0.80
IGL02893:Nwd1	APN	8	73,394,129 (GRCm39)	missense	probably damaging	1.00
IGL03010:Nwd1	APN	8	73,414,688 (GRCm39)	splice site	probably benign
R0017:Nwd1	UTSW	8	73,436,053 (GRCm39)	splice site	probably benign
R0066:Nwd1	UTSW	8	73,438,484 (GRCm39)	missense	probably benign	0.27
R0066:Nwd1	UTSW	8	73,438,484 (GRCm39)	missense	probably benign	0.27
R0505:Nwd1	UTSW	8	73,388,965 (GRCm39)	missense	probably damaging	0.96
R0511:Nwd1	UTSW	8	73,408,633 (GRCm39)	missense	probably damaging	1.00
R0612:Nwd1	UTSW	8	73,394,308 (GRCm39)	missense	probably damaging	0.99
R0681:Nwd1	UTSW	8	73,388,965 (GRCm39)	missense	probably damaging	0.96
R0763:Nwd1	UTSW	8	73,397,672 (GRCm39)	missense	probably damaging	1.00
R1136:Nwd1	UTSW	8	73,424,397 (GRCm39)	splice site	probably benign
R1483:Nwd1	UTSW	8	73,383,714 (GRCm39)	missense	probably damaging	0.96
R1630:Nwd1	UTSW	8	73,393,657 (GRCm39)	missense	possibly damaging	0.66
R1724:Nwd1	UTSW	8	73,438,248 (GRCm39)	missense	probably damaging	1.00
R1732:Nwd1	UTSW	8	73,393,463 (GRCm39)	missense	possibly damaging	0.96
R1885:Nwd1	UTSW	8	73,431,622 (GRCm39)	missense	probably benign	0.00
R1973:Nwd1	UTSW	8	73,431,590 (GRCm39)	missense	possibly damaging	0.46
R2393:Nwd1	UTSW	8	73,389,055 (GRCm39)	missense	probably benign
R2926:Nwd1	UTSW	8	73,393,640 (GRCm39)	missense	probably damaging	1.00
R3706:Nwd1	UTSW	8	73,393,744 (GRCm39)	missense	possibly damaging	0.66
R3916:Nwd1	UTSW	8	73,394,439 (GRCm39)	nonsense	probably null
R3917:Nwd1	UTSW	8	73,394,439 (GRCm39)	nonsense	probably null
R4153:Nwd1	UTSW	8	73,408,564 (GRCm39)	missense	probably damaging	1.00
R4426:Nwd1	UTSW	8	73,393,423 (GRCm39)	missense	probably damaging	1.00
R4435:Nwd1	UTSW	8	73,414,764 (GRCm39)	missense	possibly damaging	0.46
R4522:Nwd1	UTSW	8	73,397,579 (GRCm39)	missense	probably damaging	1.00
R4622:Nwd1	UTSW	8	73,393,928 (GRCm39)	missense	probably damaging	1.00
R4659:Nwd1	UTSW	8	73,421,949 (GRCm39)	missense	probably benign	0.03
R4694:Nwd1	UTSW	8	73,393,958 (GRCm39)	missense	probably damaging	1.00
R4837:Nwd1	UTSW	8	73,383,759 (GRCm39)	missense	probably damaging	1.00
R4844:Nwd1	UTSW	8	73,393,742 (GRCm39)	missense	probably damaging	1.00
R4906:Nwd1	UTSW	8	73,398,841 (GRCm39)	missense	probably damaging	1.00
R5041:Nwd1	UTSW	8	73,431,683 (GRCm39)	missense	possibly damaging	0.90
R5183:Nwd1	UTSW	8	73,397,714 (GRCm39)	missense	probably benign	0.07
R5416:Nwd1	UTSW	8	73,393,322 (GRCm39)	missense	possibly damaging	0.90
R5553:Nwd1	UTSW	8	73,431,604 (GRCm39)	missense	possibly damaging	0.83
R5670:Nwd1	UTSW	8	73,419,745 (GRCm39)	missense	probably damaging	0.97
R5699:Nwd1	UTSW	8	73,429,602 (GRCm39)	critical splice donor site	probably null
R5722:Nwd1	UTSW	8	73,401,872 (GRCm39)	missense	probably damaging	0.97
R5762:Nwd1	UTSW	8	73,397,542 (GRCm39)	missense	probably damaging	1.00
R5778:Nwd1	UTSW	8	73,419,745 (GRCm39)	missense	probably damaging	0.97
R5992:Nwd1	UTSW	8	73,380,201 (GRCm39)	critical splice donor site	probably null
R6163:Nwd1	UTSW	8	73,388,814 (GRCm39)	missense	probably damaging	0.96
R6164:Nwd1	UTSW	8	73,388,814 (GRCm39)	missense	probably damaging	0.96
R6165:Nwd1	UTSW	8	73,388,814 (GRCm39)	missense	probably damaging	0.96
R6212:Nwd1	UTSW	8	73,421,950 (GRCm39)	missense	possibly damaging	0.95
R6443:Nwd1	UTSW	8	73,388,994 (GRCm39)	missense	possibly damaging	0.58
R6865:Nwd1	UTSW	8	73,383,690 (GRCm39)	missense	possibly damaging	0.63
R6928:Nwd1	UTSW	8	73,408,653 (GRCm39)	missense	probably benign	0.27
R6944:Nwd1	UTSW	8	73,380,162 (GRCm39)	missense	possibly damaging	0.69
R6979:Nwd1	UTSW	8	73,394,288 (GRCm39)	missense	probably damaging	1.00
R7060:Nwd1	UTSW	8	73,393,322 (GRCm39)	missense	probably damaging	1.00
R7102:Nwd1	UTSW	8	73,421,957 (GRCm39)	missense	probably damaging	1.00
R7265:Nwd1	UTSW	8	73,419,556 (GRCm39)	missense	probably benign	0.29
R7343:Nwd1	UTSW	8	73,438,410 (GRCm39)	missense	probably damaging	0.98
R7391:Nwd1	UTSW	8	73,389,046 (GRCm39)	missense	probably damaging	0.99
R7424:Nwd1	UTSW	8	73,401,801 (GRCm39)	missense	possibly damaging	0.86
R7438:Nwd1	UTSW	8	73,434,458 (GRCm39)	missense	probably benign	0.00
R7487:Nwd1	UTSW	8	73,393,266 (GRCm39)	missense	unknown
R7502:Nwd1	UTSW	8	73,434,021 (GRCm39)	missense	probably damaging	0.98
R7883:Nwd1	UTSW	8	73,393,754 (GRCm39)	missense	probably damaging	1.00
R8235:Nwd1	UTSW	8	73,438,314 (GRCm39)	frame shift	probably null
R8282:Nwd1	UTSW	8	73,431,580 (GRCm39)	missense	probably damaging	0.99
R8672:Nwd1	UTSW	8	73,394,007 (GRCm39)	missense	probably damaging	1.00
R8716:Nwd1	UTSW	8	73,388,908 (GRCm39)	missense	probably damaging	1.00
R8755:Nwd1	UTSW	8	73,394,192 (GRCm39)	missense	probably damaging	0.98
R8793:Nwd1	UTSW	8	73,419,704 (GRCm39)	missense	probably benign
R8890:Nwd1	UTSW	8	73,438,484 (GRCm39)	missense	probably benign	0.27
R9072:Nwd1	UTSW	8	73,422,046 (GRCm39)	missense	probably benign	0.00
R9073:Nwd1	UTSW	8	73,422,046 (GRCm39)	missense	probably benign	0.00
R9257:Nwd1	UTSW	8	73,397,566 (GRCm39)	missense	probably damaging	1.00
R9582:Nwd1	UTSW	8	73,421,917 (GRCm39)	missense	probably damaging	1.00
R9665:Nwd1	UTSW	8	73,401,106 (GRCm39)	missense	probably damaging	1.00
X0067:Nwd1	UTSW	8	73,393,884 (GRCm39)	missense	possibly damaging	0.81
Z1176:Nwd1	UTSW	8	73,398,928 (GRCm39)	missense	not run
Z1177:Nwd1	UTSW	8	73,436,087 (GRCm39)	missense	probably damaging	0.99
Z1177:Nwd1	UTSW	8	73,422,015 (GRCm39)	missense	possibly damaging	0.48
Z1177:Nwd1	UTSW	8	73,393,256 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCCAGGTGAATATCTCAGTGTGGAC -3'
(R):5'- ACTCAACCTCTACCCTACCTATGTGC -3'

Sequencing Primer
(F):5'- ttccatcccctctaacaacac -3'
(R):5'- agagagagagagagagagagagagag -3'

Posted On

2013-11-08