Incidental Mutation 'R0906:AA986860'
ID83310
Institutional Source Beutler Lab
Gene Symbol AA986860
Ensembl Gene ENSMUSG00000042510
Gene Nameexpressed sequence AA986860
Synonyms
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130731976-130744622 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 130737693 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039323]
Predicted Effect probably benign
Transcript: ENSMUST00000039323
SMART Domains Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510

DomainStartEndE-ValueType
Pfam:SARG 33 606 1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190859
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in AA986860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:AA986860 APN 1 130742836 missense possibly damaging 0.69
IGL01761:AA986860 APN 1 130742722 missense possibly damaging 0.70
IGL02557:AA986860 APN 1 130742707 missense probably benign 0.02
IGL03003:AA986860 APN 1 130743772 missense probably damaging 1.00
IGL02802:AA986860 UTSW 1 130743393 missense probably benign 0.00
R0326:AA986860 UTSW 1 130742898 missense possibly damaging 0.87
R0483:AA986860 UTSW 1 130743825 missense probably damaging 1.00
R0932:AA986860 UTSW 1 130737693 splice site probably null
R1522:AA986860 UTSW 1 130743094 missense probably damaging 1.00
R1762:AA986860 UTSW 1 130737688 critical splice donor site probably null
R1874:AA986860 UTSW 1 130742691 missense probably benign 0.06
R2083:AA986860 UTSW 1 130741069 missense probably damaging 1.00
R2091:AA986860 UTSW 1 130743169 missense probably benign 0.01
R2093:AA986860 UTSW 1 130743304 missense probably benign 0.13
R3546:AA986860 UTSW 1 130741189 splice site probably benign
R3915:AA986860 UTSW 1 130742607 missense probably benign
R4679:AA986860 UTSW 1 130742403 missense possibly damaging 0.67
R4703:AA986860 UTSW 1 130743355 missense probably benign 0.19
R4890:AA986860 UTSW 1 130740988 splice site probably benign
R4988:AA986860 UTSW 1 130742710 missense probably damaging 1.00
R5171:AA986860 UTSW 1 130742847 missense probably benign 0.23
R5327:AA986860 UTSW 1 130741003 missense probably damaging 1.00
R5424:AA986860 UTSW 1 130742941 missense probably damaging 1.00
R5763:AA986860 UTSW 1 130743031 missense possibly damaging 0.53
R5799:AA986860 UTSW 1 130741171 nonsense probably null
R6247:AA986860 UTSW 1 130743043 missense possibly damaging 0.78
R7124:AA986860 UTSW 1 130742887 missense possibly damaging 0.67
R7747:AA986860 UTSW 1 130743547 missense possibly damaging 0.60
Z1176:AA986860 UTSW 1 130742991 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTGCAGAAGCCTCAGCTCACAC -3'
(R):5'- TGTCCCACCCAGTTCTCTACAGAAG -3'

Sequencing Primer
(F):5'- GCCCAGCTTGGGACATTC -3'
(R):5'- TCTCTACAGAAGCAGATGTGACTC -3'
Posted On2013-11-08