Mutagenetix > Incidental Mutations

Incidental Mutation 'R0906:Lgr6'

83311

Institutional Source

Beutler Lab

Gene Symbol

Lgr6

Ensembl Gene

ENSMUSG00000042793

Gene Name

leucine-rich repeat-containing G protein-coupled receptor 6

Synonyms

A530037C04Rik

MMRRC Submission

039064-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0906 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134983301-135105276 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 134994010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 199 (A199T)

Ref Sequence

ENSEMBL: ENSMUSP00000122334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]

AlphaFold

Q3UVD5

Predicted Effect

probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
LRRNT	34	70	5.19e-3	SMART
LRR	64	88	1.03e1	SMART
LRR_TYP	89	112	6.52e-5	SMART
LRR_TYP	113	136	2.71e-2	SMART
LRR_TYP	137	160	4.79e-3	SMART
LRR_TYP	161	184	1.58e-3	SMART
LRR_TYP	185	208	2.36e-2	SMART
LRR_TYP	209	232	3.39e-3	SMART
LRR	233	255	8.97e0	SMART
LRR_TYP	256	279	1.36e-2	SMART
Blast:LRR	281	303	6e-7	BLAST
LRR	327	350	9.24e1	SMART
LRR	351	373	1.41e0	SMART
LRR	374	396	4.84e1	SMART
LRR_TYP	397	420	4.54e-4	SMART
LRR_TYP	421	444	7.15e-2	SMART
transmembrane domain	568	590	N/A	INTRINSIC
transmembrane domain	599	621	N/A	INTRINSIC
transmembrane domain	643	665	N/A	INTRINSIC
transmembrane domain	686	708	N/A	INTRINSIC
transmembrane domain	728	750	N/A	INTRINSIC
transmembrane domain	776	798	N/A	INTRINSIC
transmembrane domain	808	830	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

Domain	Start	End	E-Value	Type
Blast:LRR	4	26	2e-7	BLAST
LRR	50	73	9.24e1	SMART
LRR	74	96	1.41e0	SMART
LRR	97	119	4.84e1	SMART
LRR_TYP	120	143	4.54e-4	SMART
LRR_TYP	144	167	7.15e-2	SMART
Pfam:7tm_1	301	550	3.6e-9	PFAM

Meta Mutation Damage Score

0.1650

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	T	A	1: 130,737,693		probably benign	Het
Atp7b	T	C	8: 22,027,826	H332R	probably benign	Het
Bace2	C	T	16: 97,356,941	P47L	possibly damaging	Het
Cyp2c39	A	G	19: 39,510,871	M1V	probably null	Het
Dcbld2	A	G	16: 58,455,247	E442G	probably damaging	Het
Gm14496	A	G	2: 182,000,515	T660A	probably damaging	Het
Gm4945	A	C	17: 47,042,870		noncoding transcript	Het
Gm5065	T	C	7: 5,359,829	I153T	probably damaging	Het
Gm6729	T	C	10: 86,540,592		noncoding transcript	Het
Golga1	G	A	2: 39,047,643	R204W	probably damaging	Het
Guf1	T	C	5: 69,566,386	I348T	probably damaging	Het
Htra4	T	A	8: 25,037,144	I212L	probably benign	Het
Itih5	G	A	2: 10,249,188	R750Q	probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nsd1	T	C	13: 55,277,590	V1520A	probably benign	Het
Nuak1	C	T	10: 84,375,280	V315I	probably damaging	Het
Nup205	G	T	6: 35,236,892	G1740C	probably damaging	Het
Olfr398	G	C	11: 73,983,859	L250V	probably damaging	Het
Pclo	T	C	5: 14,676,686		probably benign	Het
Pik3r6	T	C	11: 68,536,101		probably benign	Het
Pikfyve	T	A	1: 65,253,397	F1336I	probably damaging	Het
Pla2r1	A	G	2: 60,514,947	I355T	possibly damaging	Het
Rgs22	A	T	15: 36,103,902		probably benign	Het
Sec63	T	A	10: 42,801,928	M312K	probably damaging	Het
Slc2a5	T	C	4: 150,142,830	I401T	probably benign	Het
Slc9a8	G	T	2: 167,434,867		probably benign	Het
Stab1	T	C	14: 31,145,249	E1718G	probably benign	Het
Terb1	A	T	8: 104,452,636	I640N	probably damaging	Het
Tmem217	A	G	17: 29,526,516	L80P	probably damaging	Het
Topbp1	C	T	9: 103,328,593	P810L	probably benign	Het
Ttbk2	G	A	2: 120,783,781	R151C	probably damaging	Het
Vmn2r88	T	G	14: 51,418,209	L626R	probably damaging	Het

Other mutations in Lgr6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02481:Lgr6	APN	1	135001691	splice site	probably benign
IGL02483:Lgr6	APN	1	135001691	splice site	probably benign
IGL03270:Lgr6	APN	1	134997704	missense	probably damaging	1.00
R0002:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0294:Lgr6	UTSW	1	134987891	missense	probably damaging	0.99
R0294:Lgr6	UTSW	1	135105061	missense	unknown
R0361:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0390:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0731:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0734:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0741:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0742:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0765:Lgr6	UTSW	1	134993886	missense	probably benign	0.04
R0903:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0904:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0905:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0907:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0908:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R0967:Lgr6	UTSW	1	134994012	missense	probably damaging	1.00
R1078:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R1079:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R1131:Lgr6	UTSW	1	134987304	missense	probably damaging	0.98
R1440:Lgr6	UTSW	1	134987472	missense	probably damaging	1.00
R1533:Lgr6	UTSW	1	135104932	missense	possibly damaging	0.66
R1728:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1728:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1728:Lgr6	UTSW	1	135003476	missense	probably benign
R1729:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1729:Lgr6	UTSW	1	134988009	missense	probably benign
R1729:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1729:Lgr6	UTSW	1	135003476	missense	probably benign
R1730:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1730:Lgr6	UTSW	1	134988009	missense	probably benign
R1730:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1730:Lgr6	UTSW	1	135003476	missense	probably benign
R1739:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1739:Lgr6	UTSW	1	134988009	missense	probably benign
R1739:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1739:Lgr6	UTSW	1	135003476	missense	probably benign
R1762:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1762:Lgr6	UTSW	1	134988009	missense	probably benign
R1762:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1762:Lgr6	UTSW	1	135003476	missense	probably benign
R1782:Lgr6	UTSW	1	134987979	missense	probably damaging	0.98
R1783:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1783:Lgr6	UTSW	1	134988009	missense	probably benign
R1783:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1783:Lgr6	UTSW	1	135003476	missense	probably benign
R1784:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1784:Lgr6	UTSW	1	134988009	missense	probably benign
R1784:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1784:Lgr6	UTSW	1	135003476	missense	probably benign
R1785:Lgr6	UTSW	1	134987088	missense	probably benign	0.00
R1785:Lgr6	UTSW	1	134988009	missense	probably benign
R1785:Lgr6	UTSW	1	134990635	missense	probably benign	0.18
R1785:Lgr6	UTSW	1	135003476	missense	probably benign
R2020:Lgr6	UTSW	1	135075275	missense	probably damaging	1.00
R3104:Lgr6	UTSW	1	135000472	splice site	probably null
R4629:Lgr6	UTSW	1	135104932	missense	probably damaging	0.99
R4792:Lgr6	UTSW	1	135021806	missense	probably benign	0.03
R5001:Lgr6	UTSW	1	134990632	missense	probably benign	0.01
R5191:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5194:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5195:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5196:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5197:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5228:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5230:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5243:Lgr6	UTSW	1	135109272	unclassified	probably benign
R5299:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5300:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5417:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5419:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5601:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5603:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5636:Lgr6	UTSW	1	134987078	missense	probably benign	0.28
R5699:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5748:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5767:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5825:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R5971:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6078:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6079:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6138:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6258:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6259:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6260:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6740:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6871:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00
R6984:Lgr6	UTSW	1	134988002	missense	possibly damaging	0.54
R6986:Lgr6	UTSW	1	134993956	missense	possibly damaging	0.80
R7233:Lgr6	UTSW	1	135000476	critical splice donor site	probably null
R7699:Lgr6	UTSW	1	134996032	missense	probably damaging	1.00
R7700:Lgr6	UTSW	1	134996032	missense	probably damaging	1.00
R7734:Lgr6	UTSW	1	135003243	missense	probably damaging	1.00
R7849:Lgr6	UTSW	1	134987681	missense	probably damaging	1.00
R7970:Lgr6	UTSW	1	134993985	missense	probably benign
R8068:Lgr6	UTSW	1	135063664	missense	probably benign	0.00
R8252:Lgr6	UTSW	1	135003477	missense	probably null	0.78
R8516:Lgr6	UTSW	1	135075283	missense	probably damaging	1.00
R8771:Lgr6	UTSW	1	135005691	nonsense	probably null
R8858:Lgr6	UTSW	1	134996111	critical splice acceptor site	probably null
R8885:Lgr6	UTSW	1	134987604	missense	probably benign	0.00
R9014:Lgr6	UTSW	1	135003510	missense	probably damaging	1.00
R9277:Lgr6	UTSW	1	134987479	nonsense	probably null
Z1088:Lgr6	UTSW	1	134988071	missense	possibly damaging	0.89
Z1191:Lgr6	UTSW	1	134994010	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTCACAGTGGTTCTCAGCTTGTC -3'
(R):5'- AGAGTCCTTTGGGGTCAGGAATCAG -3'

Sequencing Primer
(F):5'- TCTCAGCTTGTCCAGCAAGG -3'
(R):5'- cacctaaaaccaccagaaacac -3'

Posted On

2013-11-08