Mutagenetix > Incidental Mutations

Incidental Mutation 'R0906:Itih5'

83312

Institutional Source

Beutler Lab

Gene Symbol

Itih5

Ensembl Gene

ENSMUSG00000025780

Gene Name

inter-alpha (globulin) inhibitor H5

Synonyms

5430408M01Rik, 4631408O11Rik

MMRRC Submission

039064-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R0906 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10153571-10256529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 10249188 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 750 (R750Q)

Ref Sequence

ENSEMBL: ENSMUSP00000026886 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026886]

Predicted Effect

probably benign
Transcript: ENSMUST00000026886
AA Change: R750Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: R750Q

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	30	45	N/A	INTRINSIC
Pfam:VIT	51	159	5.5e-27	PFAM
VWA	293	476	5.84e-24	SMART
Pfam:ITI_HC_C	716	909	1.7e-60	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	T	A	1: 130,737,693		probably benign	Het
Atp7b	T	C	8: 22,027,826	H332R	probably benign	Het
Bace2	C	T	16: 97,356,941	P47L	possibly damaging	Het
Cyp2c39	A	G	19: 39,510,871	M1V	probably null	Het
Dcbld2	A	G	16: 58,455,247	E442G	probably damaging	Het
Gm14496	A	G	2: 182,000,515	T660A	probably damaging	Het
Gm4945	A	C	17: 47,042,870		noncoding transcript	Het
Gm5065	T	C	7: 5,359,829	I153T	probably damaging	Het
Gm6729	T	C	10: 86,540,592		noncoding transcript	Het
Golga1	G	A	2: 39,047,643	R204W	probably damaging	Het
Guf1	T	C	5: 69,566,386	I348T	probably damaging	Het
Htra4	T	A	8: 25,037,144	I212L	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nsd1	T	C	13: 55,277,590	V1520A	probably benign	Het
Nuak1	C	T	10: 84,375,280	V315I	probably damaging	Het
Nup205	G	T	6: 35,236,892	G1740C	probably damaging	Het
Olfr398	G	C	11: 73,983,859	L250V	probably damaging	Het
Pclo	T	C	5: 14,676,686		probably benign	Het
Pik3r6	T	C	11: 68,536,101		probably benign	Het
Pikfyve	T	A	1: 65,253,397	F1336I	probably damaging	Het
Pla2r1	A	G	2: 60,514,947	I355T	possibly damaging	Het
Rgs22	A	T	15: 36,103,902		probably benign	Het
Sec63	T	A	10: 42,801,928	M312K	probably damaging	Het
Slc2a5	T	C	4: 150,142,830	I401T	probably benign	Het
Slc9a8	G	T	2: 167,434,867		probably benign	Het
Stab1	T	C	14: 31,145,249	E1718G	probably benign	Het
Terb1	A	T	8: 104,452,636	I640N	probably damaging	Het
Tmem217	A	G	17: 29,526,516	L80P	probably damaging	Het
Topbp1	C	T	9: 103,328,593	P810L	probably benign	Het
Ttbk2	G	A	2: 120,783,781	R151C	probably damaging	Het
Vmn2r88	T	G	14: 51,418,209	L626R	probably damaging	Het

Other mutations in Itih5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01481:Itih5	APN	2	10190289	missense	probably damaging	1.00
IGL02125:Itih5	APN	2	10240987	missense	probably benign
IGL02370:Itih5	APN	2	10186975	missense	probably benign	0.05
IGL03376:Itih5	APN	2	10206773	missense	probably benign	0.12
IGL02991:Itih5	UTSW	2	10251351	missense	probably benign	0.01
R0090:Itih5	UTSW	2	10164684	missense	probably benign	0.03
R0096:Itih5	UTSW	2	10251378	missense	probably benign	0.02
R0096:Itih5	UTSW	2	10251378	missense	probably benign	0.02
R0158:Itih5	UTSW	2	10234992	splice site	probably benign
R0270:Itih5	UTSW	2	10251264	missense	probably benign	0.38
R0276:Itih5	UTSW	2	10185564	missense	possibly damaging	0.80
R0807:Itih5	UTSW	2	10249188	missense	probably benign	0.00
R0810:Itih5	UTSW	2	10249188	missense	probably benign	0.00
R0903:Itih5	UTSW	2	10249188	missense	probably benign	0.00
R0905:Itih5	UTSW	2	10249188	missense	probably benign	0.00
R1104:Itih5	UTSW	2	10251512	missense	probably benign	0.03
R1397:Itih5	UTSW	2	10240807	missense	probably benign	0.14
R1671:Itih5	UTSW	2	10186971	missense	probably benign	0.03
R1971:Itih5	UTSW	2	10238568	missense	probably damaging	1.00
R3684:Itih5	UTSW	2	10238624	missense	possibly damaging	0.93
R3685:Itih5	UTSW	2	10238624	missense	possibly damaging	0.93
R3831:Itih5	UTSW	2	10251270	missense	possibly damaging	0.95
R3934:Itih5	UTSW	2	10245544	missense	probably damaging	0.98
R4670:Itih5	UTSW	2	10190369	missense	probably benign	0.01
R4803:Itih5	UTSW	2	10240581	missense	probably benign
R4950:Itih5	UTSW	2	10235081	missense	probably damaging	0.98
R5020:Itih5	UTSW	2	10240504	splice site	probably null
R5735:Itih5	UTSW	2	10240761	missense	probably benign	0.00
R6454:Itih5	UTSW	2	10240668	missense	probably benign
R6662:Itih5	UTSW	2	10249181	missense	probably benign	0.13
R7019:Itih5	UTSW	2	10190327	missense	probably damaging	1.00
R7068:Itih5	UTSW	2	10249304	missense	probably damaging	0.99
R7246:Itih5	UTSW	2	10187062	splice site	probably null
R7424:Itih5	UTSW	2	10245637	missense	probably damaging	1.00
R7452:Itih5	UTSW	2	10238796	missense	probably damaging	1.00
R7597:Itih5	UTSW	2	10249376	missense	probably damaging	1.00
R8025:Itih5	UTSW	2	10241022	missense	probably benign	0.13
R8253:Itih5	UTSW	2	10238595	missense	probably benign	0.06
R8349:Itih5	UTSW	2	10186989	missense	probably benign	0.01
R8439:Itih5	UTSW	2	10235058	missense	probably benign	0.19
R8449:Itih5	UTSW	2	10186989	missense	probably benign	0.01
X0026:Itih5	UTSW	2	10238559	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGATGCCTTCAGCCGGAAAATAGAC -3'
(R):5'- GTCACGCCCTCACTGTAAATTCCTG -3'

Sequencing Primer
(F):5'- CTTCAGCCGGAAAATAGACATGAG -3'
(R):5'- TTGGCGATGTAGAAGCCC -3'

Posted On

2013-11-08