Incidental Mutation 'R0906:Golga1'
ID83313
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Namegolgi autoantigen, golgin subfamily a, 1
Synonyms0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location39016155-39065541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39047643 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 204 (R204W)
Ref Sequence ENSEMBL: ENSMUSP00000108471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000149810] [ENSMUST00000184996]
Predicted Effect probably damaging
Transcript: ENSMUST00000039165
AA Change: R229W

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: R229W

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112850
AA Change: R204W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: R204W

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136261
Predicted Effect probably damaging
Transcript: ENSMUST00000149810
AA Change: R130W

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145206
Gene: ENSMUSG00000026754
AA Change: R130W

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
coiled coil region 70 183 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153914
AA Change: R146W
Predicted Effect probably damaging
Transcript: ENSMUST00000184996
AA Change: R229W

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: R229W

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 39052973 nonsense probably null
IGL00949:Golga1 APN 2 39041255 missense probably damaging 0.98
IGL01133:Golga1 APN 2 39023472 missense probably benign
IGL01592:Golga1 APN 2 39063282 missense probably damaging 1.00
IGL01613:Golga1 APN 2 39020126 missense probably benign 0.14
IGL01819:Golga1 APN 2 39034149 missense probably benign 0.00
IGL01871:Golga1 APN 2 39050198 splice site probably benign
IGL02744:Golga1 APN 2 39018474 missense probably damaging 1.00
IGL02819:Golga1 APN 2 39039078 missense probably null 0.97
IGL02874:Golga1 APN 2 39039092 missense probably damaging 1.00
R0167:Golga1 UTSW 2 39047648 missense probably benign 0.00
R0245:Golga1 UTSW 2 39035259 missense probably benign 0.00
R0389:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0443:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R1508:Golga1 UTSW 2 39023249 missense probably benign
R1901:Golga1 UTSW 2 39047780 splice site probably null
R1964:Golga1 UTSW 2 39047087 missense probably benign 0.00
R2228:Golga1 UTSW 2 39023171 missense probably benign 0.02
R3734:Golga1 UTSW 2 39050170 missense possibly damaging 0.88
R4407:Golga1 UTSW 2 39019641 unclassified probably null
R4504:Golga1 UTSW 2 39023454 missense probably benign 0.00
R4973:Golga1 UTSW 2 39039106 missense probably damaging 0.99
R5049:Golga1 UTSW 2 39047735 missense probably damaging 1.00
R5600:Golga1 UTSW 2 39020099 missense probably damaging 1.00
R6008:Golga1 UTSW 2 39047087 missense probably benign 0.00
R6374:Golga1 UTSW 2 39034068 missense probably benign
R6388:Golga1 UTSW 2 39023171 missense probably benign 0.02
R6601:Golga1 UTSW 2 39020106 missense probably damaging 1.00
R7067:Golga1 UTSW 2 39047719 missense probably benign 0.00
R7816:Golga1 UTSW 2 39052098 missense probably damaging 1.00
X0025:Golga1 UTSW 2 39052062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCTTTGCCAGCACTGAG -3'
(R):5'- AGTACCAATGAGCAGTGAGCCTTTATG -3'

Sequencing Primer
(F):5'- CCAGCACTGAGATAAAAAGGTTCTG -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On2013-11-08