Incidental Mutation 'R0906:Pla2r1'
ID 83314
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Name phospholipase A2 receptor 1
Synonyms M-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission 039064-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0906 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 60417543-60553308 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60514947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 355 (I355T)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
AlphaFold Q62028
Predicted Effect possibly damaging
Transcript: ENSMUST00000112525
AA Change: I355T

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: I355T

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128208
Meta Mutation Damage Score 0.4787 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
R7350:Pla2r1 UTSW 2 60458379 missense probably benign 0.02
R7451:Pla2r1 UTSW 2 60535002 missense probably damaging 1.00
R7553:Pla2r1 UTSW 2 60522899 missense possibly damaging 0.80
R7635:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R7768:Pla2r1 UTSW 2 60448946 missense probably benign 0.22
R7774:Pla2r1 UTSW 2 60530458 nonsense probably null
R7782:Pla2r1 UTSW 2 60504187 missense probably benign 0.01
R7832:Pla2r1 UTSW 2 60504192 missense possibly damaging 0.79
R7843:Pla2r1 UTSW 2 60447475 missense possibly damaging 0.88
R7900:Pla2r1 UTSW 2 60428514 missense possibly damaging 0.94
R8010:Pla2r1 UTSW 2 60514960 missense probably benign 0.00
R8129:Pla2r1 UTSW 2 60432600 missense probably damaging 1.00
R8336:Pla2r1 UTSW 2 60422683 missense possibly damaging 0.88
R8347:Pla2r1 UTSW 2 60534903 missense probably damaging 0.98
R8359:Pla2r1 UTSW 2 60443283 missense probably benign 0.00
R8682:Pla2r1 UTSW 2 60422776 missense possibly damaging 0.89
R8845:Pla2r1 UTSW 2 60428709 missense possibly damaging 0.52
R8901:Pla2r1 UTSW 2 60502056 missense
R9085:Pla2r1 UTSW 2 60425447 missense probably damaging 0.99
R9130:Pla2r1 UTSW 2 60495385 intron probably benign
R9140:Pla2r1 UTSW 2 60441111 missense probably benign 0.10
R9399:Pla2r1 UTSW 2 60452400 critical splice donor site probably null
R9449:Pla2r1 UTSW 2 60428558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGGAATGTTGACTCGGCTAATG -3'
(R):5'- AAGGGCTACCTTCTGTGCTGCAAG -3'

Sequencing Primer
(F):5'- GCATGGTACTTCAGGATGGC -3'
(R):5'- CTGTGCTGCAAGCATTTCTG -3'
Posted On 2013-11-08