Incidental Mutation 'R0906:Ttbk2'
ID83315
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Nametau tubulin kinase 2
SynonymsB930008N24Rik, 2610507N02Rik, TTK
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120732816-120850604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120783781 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 151 (R151C)
Ref Sequence ENSEMBL: ENSMUSP00000121996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000131389] [ENSMUST00000143051]
Predicted Effect probably damaging
Transcript: ENSMUST00000028740
AA Change: R220C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: R220C

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057135
AA Change: R151C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: R151C

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085840
AA Change: R151C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: R151C

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131389
SMART Domains Protein: ENSMUSP00000118905
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 145 1.3e-18 PFAM
Pfam:Pkinase_Tyr 21 148 9.7e-12 PFAM
Pfam:Pkinase 145 239 1.2e-5 PFAM
low complexity region 265 279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143051
AA Change: R151C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100
AA Change: R151C

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148285
Meta Mutation Damage Score 0.2261 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0279:Ttbk2 UTSW 2 120748960 missense probably benign 0.00
R0362:Ttbk2 UTSW 2 120745783 missense possibly damaging 0.90
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 unclassified probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4962:Ttbk2 UTSW 2 120745150 missense probably damaging 1.00
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7013:Ttbk2 UTSW 2 120745784 missense possibly damaging 0.89
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
R7475:Ttbk2 UTSW 2 120748640 missense probably benign 0.01
R7891:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
R7974:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
RF021:Ttbk2 UTSW 2 120748634 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCTTTTGGACAAGATCAAGTGT -3'
(R):5'- TGCTCAGTTTCCCTGATGGTAGACA -3'

Sequencing Primer
(F):5'- TTTGGACAAGATCAAGTGTAAAGTG -3'
(R):5'- CCCTTGAGAGGTAGAATCTGCAAC -3'
Posted On2013-11-08