Mutagenetix > Incidental Mutation

Incidental Mutation 'R0906:Slc9a8'

83316

Institutional Source

Beutler Lab

Gene Symbol

Slc9a8

Ensembl Gene

ENSMUSG00000039463

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 8

Synonyms

1200006P13Rik, 6430709P13Rik, NHE8

MMRRC Submission

039064-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0906 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

167421712-167477000 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to T at 167434867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]

AlphaFold

Q8R4D1

Predicted Effect

probably benign
Transcript: ENSMUST00000047815

SMART Domains

Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	57	468	3.3e-69	PFAM
low complexity region	497	513	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000073873

SMART Domains

Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	54	441	3.5e-62	PFAM
low complexity region	470	486	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109218

SMART Domains

Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	54	437	3.7e-61	PFAM
low complexity region	466	482	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124139

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131956

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135353

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149607

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	T	A	1: 130,737,693		probably benign	Het
Atp7b	T	C	8: 22,027,826	H332R	probably benign	Het
Bace2	C	T	16: 97,356,941	P47L	possibly damaging	Het
Cyp2c39	A	G	19: 39,510,871	M1V	probably null	Het
Dcbld2	A	G	16: 58,455,247	E442G	probably damaging	Het
Gm14496	A	G	2: 182,000,515	T660A	probably damaging	Het
Gm4945	A	C	17: 47,042,870		noncoding transcript	Het
Gm5065	T	C	7: 5,359,829	I153T	probably damaging	Het
Gm6729	T	C	10: 86,540,592		noncoding transcript	Het
Golga1	G	A	2: 39,047,643	R204W	probably damaging	Het
Guf1	T	C	5: 69,566,386	I348T	probably damaging	Het
Htra4	T	A	8: 25,037,144	I212L	probably benign	Het
Itih5	G	A	2: 10,249,188	R750Q	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nsd1	T	C	13: 55,277,590	V1520A	probably benign	Het
Nuak1	C	T	10: 84,375,280	V315I	probably damaging	Het
Nup205	G	T	6: 35,236,892	G1740C	probably damaging	Het
Olfr398	G	C	11: 73,983,859	L250V	probably damaging	Het
Pclo	T	C	5: 14,676,686		probably benign	Het
Pik3r6	T	C	11: 68,536,101		probably benign	Het
Pikfyve	T	A	1: 65,253,397	F1336I	probably damaging	Het
Pla2r1	A	G	2: 60,514,947	I355T	possibly damaging	Het
Rgs22	A	T	15: 36,103,902		probably benign	Het
Sec63	T	A	10: 42,801,928	M312K	probably damaging	Het
Slc2a5	T	C	4: 150,142,830	I401T	probably benign	Het
Stab1	T	C	14: 31,145,249	E1718G	probably benign	Het
Terb1	A	T	8: 104,452,636	I640N	probably damaging	Het
Tmem217	A	G	17: 29,526,516	L80P	probably damaging	Het
Topbp1	C	T	9: 103,328,593	P810L	probably benign	Het
Ttbk2	G	A	2: 120,783,781	R151C	probably damaging	Het
Vmn2r88	T	G	14: 51,418,209	L626R	probably damaging	Het

Other mutations in Slc9a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01616:Slc9a8	APN	2	167424166	missense	possibly damaging	0.46
IGL02626:Slc9a8	APN	2	167467677	splice site	probably benign
costello	UTSW	2	167451296	missense	probably damaging	1.00
R0270:Slc9a8	UTSW	2	167451296	missense	probably damaging	1.00
R0417:Slc9a8	UTSW	2	167457344	missense	probably benign	0.00
R0504:Slc9a8	UTSW	2	167424205	missense	probably benign
R1216:Slc9a8	UTSW	2	167424121	missense	probably benign	0.00
R1225:Slc9a8	UTSW	2	167471523	missense	probably benign	0.20
R1604:Slc9a8	UTSW	2	167471432	missense	probably benign	0.09
R1728:Slc9a8	UTSW	2	167424145	missense	probably benign	0.00
R1729:Slc9a8	UTSW	2	167424145	missense	probably benign	0.00
R1773:Slc9a8	UTSW	2	167471465	missense	possibly damaging	0.57
R1775:Slc9a8	UTSW	2	167457358	missense	probably benign	0.12
R1918:Slc9a8	UTSW	2	167424214	missense	possibly damaging	0.95
R2312:Slc9a8	UTSW	2	167451276	missense	probably benign	0.01
R3031:Slc9a8	UTSW	2	167451281	missense	probably damaging	1.00
R3752:Slc9a8	UTSW	2	167457352	missense	probably benign
R3757:Slc9a8	UTSW	2	167424130	missense	probably benign	0.01
R4499:Slc9a8	UTSW	2	167424193	missense	probably benign	0.01
R4746:Slc9a8	UTSW	2	167441170	nonsense	probably null
R4904:Slc9a8	UTSW	2	167471396	missense	possibly damaging	0.51
R4969:Slc9a8	UTSW	2	167446529	missense	probably benign	0.06
R5395:Slc9a8	UTSW	2	167467722	missense	probably damaging	0.99
R5811:Slc9a8	UTSW	2	167471387	nonsense	probably null
R5908:Slc9a8	UTSW	2	167451170	intron	probably benign
R6311:Slc9a8	UTSW	2	167451220	missense	probably damaging	1.00
R6443:Slc9a8	UTSW	2	167434821	missense	probably benign	0.00
R6494:Slc9a8	UTSW	2	167424291	missense	probably damaging	1.00
R7161:Slc9a8	UTSW	2	167465383	missense	possibly damaging	0.90
R7322:Slc9a8	UTSW	2	167451302	missense	probably damaging	1.00
R7354:Slc9a8	UTSW	2	167474131	missense	possibly damaging	0.93
R7896:Slc9a8	UTSW	2	167465358	missense	probably benign	0.07
R8095:Slc9a8	UTSW	2	167468971	missense	probably damaging	0.99
R8725:Slc9a8	UTSW	2	167473534	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCAACTGTCTGTTAGCCCG -3'
(R):5'- TCTTTGAGAAGCCCCACAGCAC -3'

Sequencing Primer
(F):5'- AGCCCGACTTCCTTGAGC -3'
(R):5'- CTTTTGGTGCAACCAGGAAGC -3'

Posted On

2013-11-08