Incidental Mutation 'R0906:Slc2a5'
ID83318
Institutional Source Beutler Lab
Gene Symbol Slc2a5
Ensembl Gene ENSMUSG00000028976
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 5
SynonymsGLUT5
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0906 (G1)
Quality Score211
Status Validated
Chromosome4
Chromosomal Location150119283-150144169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150142830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 401 (I401T)
Ref Sequence ENSEMBL: ENSMUSP00000030826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030826]
Predicted Effect probably benign
Transcript: ENSMUST00000030826
AA Change: I401T

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030826
Gene: ENSMUSG00000028976
AA Change: I401T

DomainStartEndE-ValueType
Pfam:MFS_1 16 397 1e-19 PFAM
Pfam:Sugar_tr 19 474 2.1e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151504
Meta Mutation Damage Score 0.6386 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a fructose transporter responsible for fructose uptake by the small intestine. The encoded protein also is necessary for the increase in blood pressure due to high dietary fructose consumption. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cochlear morphology and physiology with no detectable alterations in outer hair cell morphology, electromotility or nonlinear capacitance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Slc2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Slc2a5 APN 4 150125656 missense probably damaging 1.00
IGL01071:Slc2a5 APN 4 150120733 utr 5 prime probably benign
IGL01977:Slc2a5 APN 4 150142218 missense probably damaging 0.97
IGL03271:Slc2a5 APN 4 150135583 missense probably damaging 1.00
BB006:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
BB016:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R0760:Slc2a5 UTSW 4 150139667 missense probably benign
R1099:Slc2a5 UTSW 4 150142179 missense probably benign 0.01
R1809:Slc2a5 UTSW 4 150143057 missense probably damaging 1.00
R2099:Slc2a5 UTSW 4 150143177 nonsense probably null
R2152:Slc2a5 UTSW 4 150125638 missense probably damaging 1.00
R2253:Slc2a5 UTSW 4 150139990 missense possibly damaging 0.78
R2696:Slc2a5 UTSW 4 150120746 missense probably benign
R4835:Slc2a5 UTSW 4 150140005 missense probably benign 0.06
R4926:Slc2a5 UTSW 4 150120742 nonsense probably null
R5123:Slc2a5 UTSW 4 150139805 nonsense probably null
R5397:Slc2a5 UTSW 4 150139823 splice site probably null
R6209:Slc2a5 UTSW 4 150143100 missense probably benign 0.00
R6342:Slc2a5 UTSW 4 150139526 missense possibly damaging 0.93
R6547:Slc2a5 UTSW 4 150135619 missense possibly damaging 0.94
R7340:Slc2a5 UTSW 4 150139982 missense probably benign 0.44
R7507:Slc2a5 UTSW 4 150125650 missense probably damaging 1.00
R7537:Slc2a5 UTSW 4 150129069 missense possibly damaging 0.89
R7572:Slc2a5 UTSW 4 150142185 missense probably benign 0.33
R7751:Slc2a5 UTSW 4 150143134 missense probably damaging 1.00
R7929:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R8058:Slc2a5 UTSW 4 150143133 missense probably damaging 1.00
R8318:Slc2a5 UTSW 4 150139658 missense possibly damaging 0.90
R8477:Slc2a5 UTSW 4 150125662 missense probably benign 0.09
R8498:Slc2a5 UTSW 4 150126133 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGTAAGCCACTGTGCCGTCC -3'
(R):5'- CAATGAATGTCCTGCCCTTGGTCTC -3'

Sequencing Primer
(F):5'- ACTGTGCCGTCCAGGAAAG -3'
(R):5'- TCTCTGGGACGACCATGAAG -3'
Posted On2013-11-08