Incidental Mutation 'R0906:Lgalsl2'
ID 83322
Institutional Source Beutler Lab
Gene Symbol Lgalsl2
Ensembl Gene ENSMUSG00000048398
Gene Name galectin like 2
Synonyms Gm5065
MMRRC Submission 039064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R0906 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5353541-5363681 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5362828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 153 (I153T)
Ref Sequence ENSEMBL: ENSMUSP00000146867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056639] [ENSMUST00000207531]
AlphaFold Q7TPX9
Predicted Effect probably damaging
Transcript: ENSMUST00000056639
AA Change: I153T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055799
Gene: ENSMUSG00000048398
AA Change: I153T

DomainStartEndE-ValueType
GLECT 31 165 1.56e-15 SMART
Gal-bind_lectin 37 165 2.51e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207531
AA Change: I153T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.3184 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,665,430 (GRCm39) probably benign Het
Atp7b T C 8: 22,517,842 (GRCm39) H332R probably benign Het
Bace2 C T 16: 97,158,141 (GRCm39) P47L possibly damaging Het
Cyp2c39 A G 19: 39,499,315 (GRCm39) M1V probably null Het
Dcbld2 A G 16: 58,275,610 (GRCm39) E442G probably damaging Het
Gm14496 A G 2: 181,642,308 (GRCm39) T660A probably damaging Het
Gm4945 A C 17: 47,353,796 (GRCm39) noncoding transcript Het
Gm6729 T C 10: 86,376,456 (GRCm39) noncoding transcript Het
Golga1 G A 2: 38,937,655 (GRCm39) R204W probably damaging Het
Guf1 T C 5: 69,723,729 (GRCm39) I348T probably damaging Het
Htra4 T A 8: 25,527,160 (GRCm39) I212L probably benign Het
Itih5 G A 2: 10,253,999 (GRCm39) R750Q probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nsd1 T C 13: 55,425,403 (GRCm39) V1520A probably benign Het
Nuak1 C T 10: 84,211,144 (GRCm39) V315I probably damaging Het
Nup205 G T 6: 35,213,827 (GRCm39) G1740C probably damaging Het
Or1r1 G C 11: 73,874,685 (GRCm39) L250V probably damaging Het
Pclo T C 5: 14,726,700 (GRCm39) probably benign Het
Pik3r6 T C 11: 68,426,927 (GRCm39) probably benign Het
Pikfyve T A 1: 65,292,556 (GRCm39) F1336I probably damaging Het
Pla2r1 A G 2: 60,345,291 (GRCm39) I355T possibly damaging Het
Rgs22 A T 15: 36,104,048 (GRCm39) probably benign Het
Sec63 T A 10: 42,677,924 (GRCm39) M312K probably damaging Het
Slc2a5 T C 4: 150,227,287 (GRCm39) I401T probably benign Het
Slc9a8 G T 2: 167,276,787 (GRCm39) probably benign Het
Stab1 T C 14: 30,867,206 (GRCm39) E1718G probably benign Het
Terb1 A T 8: 105,179,268 (GRCm39) I640N probably damaging Het
Tmem217 A G 17: 29,745,490 (GRCm39) L80P probably damaging Het
Topbp1 C T 9: 103,205,792 (GRCm39) P810L probably benign Het
Ttbk2 G A 2: 120,614,262 (GRCm39) R151C probably damaging Het
Vmn2r88 T G 14: 51,655,666 (GRCm39) L626R probably damaging Het
Other mutations in Lgalsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02060:Lgalsl2 APN 7 5,362,563 (GRCm39) missense probably damaging 0.99
IGL02147:Lgalsl2 APN 7 5,362,732 (GRCm39) missense probably damaging 1.00
R0771:Lgalsl2 UTSW 7 5,362,822 (GRCm39) missense probably damaging 1.00
R2018:Lgalsl2 UTSW 7 5,362,573 (GRCm39) missense probably benign 0.18
R2258:Lgalsl2 UTSW 7 5,362,401 (GRCm39) missense probably benign
R2519:Lgalsl2 UTSW 7 5,362,833 (GRCm39) missense probably damaging 1.00
R2865:Lgalsl2 UTSW 7 5,362,668 (GRCm39) missense probably benign 0.25
R5893:Lgalsl2 UTSW 7 5,362,623 (GRCm39) missense probably benign 0.00
R7485:Lgalsl2 UTSW 7 5,362,440 (GRCm39) missense probably benign 0.39
R7716:Lgalsl2 UTSW 7 5,362,819 (GRCm39) missense possibly damaging 0.56
R7836:Lgalsl2 UTSW 7 5,362,507 (GRCm39) missense probably damaging 1.00
R7898:Lgalsl2 UTSW 7 5,362,441 (GRCm39) missense probably benign 0.22
R8192:Lgalsl2 UTSW 7 5,362,595 (GRCm39) missense possibly damaging 0.77
R9324:Lgalsl2 UTSW 7 5,362,527 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACTCTGAAGATCCTCCTGCCGATG -3'
(R):5'- AGCTTTCTTCTTCTGGGCAAACCAC -3'

Sequencing Primer
(F):5'- CTCTTGTATCTCAGGAGAAAGCG -3'
(R):5'- CCACAGATGAAGTTGTCATTCCAG -3'
Posted On 2013-11-08