Incidental Mutation 'R0906:Htra4'
ID83324
Institutional Source Beutler Lab
Gene Symbol Htra4
Ensembl Gene ENSMUSG00000037406
Gene NameHtrA serine peptidase 4
Synonyms
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25024929-25038962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25037144 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 212 (I212L)
Ref Sequence ENSEMBL: ENSMUSP00000081044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064883] [ENSMUST00000084031] [ENSMUST00000128715]
Predicted Effect probably benign
Transcript: ENSMUST00000064883
SMART Domains Protein: ENSMUSP00000066546
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084031
AA Change: I212L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406
AA Change: I212L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128715
SMART Domains Protein: ENSMUSP00000122564
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211059
Meta Mutation Damage Score 0.1372 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Htra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Htra4 APN 8 25033571 missense probably damaging 0.98
IGL01738:Htra4 APN 8 25025711 missense probably damaging 0.96
IGL02307:Htra4 APN 8 25033694 missense probably damaging 1.00
IGL03382:Htra4 APN 8 25029698 missense probably benign 0.17
R0057:Htra4 UTSW 8 25038808 missense probably benign
R1075:Htra4 UTSW 8 25033596 missense probably benign 0.00
R1173:Htra4 UTSW 8 25030619 missense possibly damaging 0.92
R1180:Htra4 UTSW 8 25033719 missense probably damaging 1.00
R1854:Htra4 UTSW 8 25033581 missense probably damaging 1.00
R2030:Htra4 UTSW 8 25033577 missense probably damaging 1.00
R2225:Htra4 UTSW 8 25025720 missense probably benign 0.42
R4457:Htra4 UTSW 8 25038658 missense possibly damaging 0.90
R4626:Htra4 UTSW 8 25037114 missense probably benign 0.29
R4746:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R4797:Htra4 UTSW 8 25033659 missense probably damaging 1.00
R5369:Htra4 UTSW 8 25033569 missense possibly damaging 0.95
R6846:Htra4 UTSW 8 25030545 missense probably damaging 1.00
R6911:Htra4 UTSW 8 25025705 missense probably damaging 0.96
R7067:Htra4 UTSW 8 25033701 missense probably damaging 1.00
R7367:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R7446:Htra4 UTSW 8 25037165 missense probably benign 0.09
R7603:Htra4 UTSW 8 25025700 missense probably benign 0.03
R7725:Htra4 UTSW 8 25037153 missense possibly damaging 0.94
R7729:Htra4 UTSW 8 25037077 missense possibly damaging 0.63
R7893:Htra4 UTSW 8 25033679 missense possibly damaging 0.81
R7988:Htra4 UTSW 8 25030510 critical splice donor site probably null
R8140:Htra4 UTSW 8 25030558 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGGCTCGATCTTAATCAGTGCAAGG -3'
(R):5'- GCAGATGACAGACACACAGGTTCC -3'

Sequencing Primer
(F):5'- GATCTTAATCAGTGCAAGGTCCAG -3'
(R):5'- GTTCCCACACTGATCTAAAGGAGG -3'
Posted On2013-11-08