Incidental Mutation 'R0906:Terb1'
ID83325
Institutional Source Beutler Lab
Gene Symbol Terb1
Ensembl Gene ENSMUSG00000052616
Gene Nametelomere repeat binding bouquet formation protein 1
SynonymsCcdc79, 4930532D21Rik
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104446719-104509910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104452636 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 640 (I640N)
Ref Sequence ENSEMBL: ENSMUSP00000067324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064576] [ENSMUST00000159713] [ENSMUST00000161520]
PDB Structure Solution structures of the myb-like DNA binding domain of 4930532D21Rik protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000064576
AA Change: I640N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067324
Gene: ENSMUSG00000052616
AA Change: I640N

DomainStartEndE-ValueType
SCOP:d1ee4a_ 2 368 7e-11 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
SANT 711 762 7.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159713
SMART Domains Protein: ENSMUSP00000124706
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 335 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161520
SMART Domains Protein: ENSMUSP00000125431
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 336 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162014
SMART Domains Protein: ENSMUSP00000123925
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1jdha_ 21 370 7e-8 SMART
low complexity region 382 394 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
low complexity region 688 695 N/A INTRINSIC
Meta Mutation Damage Score 0.1477 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Male and female mice homozygous for a null allele are infertile with arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Terb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Terb1 APN 8 104451807 missense probably benign 0.09
IGL01468:Terb1 APN 8 104482167 intron probably benign
IGL01619:Terb1 APN 8 104473014 missense probably benign 0.00
IGL01631:Terb1 APN 8 104472864 missense probably damaging 0.99
IGL02041:Terb1 APN 8 104495114 missense probably damaging 1.00
IGL02413:Terb1 APN 8 104494868 critical splice donor site probably null
IGL02974:Terb1 APN 8 104494968 nonsense probably null
IGL03091:Terb1 APN 8 104469154 missense probably benign 0.03
IGL03410:Terb1 APN 8 104473042 splice site probably benign
R0825:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R1175:Terb1 UTSW 8 104484306 missense probably benign 0.07
R1494:Terb1 UTSW 8 104498490 splice site probably benign
R1657:Terb1 UTSW 8 104488491 missense possibly damaging 0.77
R2018:Terb1 UTSW 8 104452699 missense probably benign 0.00
R2029:Terb1 UTSW 8 104498100 splice site probably benign
R2047:Terb1 UTSW 8 104485462 missense probably damaging 1.00
R2062:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R2179:Terb1 UTSW 8 104452715 missense probably damaging 0.99
R2179:Terb1 UTSW 8 104472737 missense probably benign 0.08
R2187:Terb1 UTSW 8 104472884 missense probably benign
R2420:Terb1 UTSW 8 104498595 missense probably damaging 1.00
R2867:Terb1 UTSW 8 104447853 unclassified probably benign
R3749:Terb1 UTSW 8 104496834 missense probably damaging 1.00
R4850:Terb1 UTSW 8 104485425 missense probably benign 0.02
R4930:Terb1 UTSW 8 104447948 missense probably benign 0.00
R4963:Terb1 UTSW 8 104482318 missense probably damaging 1.00
R4969:Terb1 UTSW 8 104495163 missense probably benign 0.00
R5100:Terb1 UTSW 8 104495173 nonsense probably null
R5440:Terb1 UTSW 8 104488499 missense probably damaging 1.00
R5824:Terb1 UTSW 8 104485447 missense probably benign 0.08
R5950:Terb1 UTSW 8 104488485 critical splice donor site probably null
R5985:Terb1 UTSW 8 104451807 missense probably benign 0.09
R5985:Terb1 UTSW 8 104482316 missense probably damaging 1.00
R6320:Terb1 UTSW 8 104447199 missense probably damaging 1.00
R6432:Terb1 UTSW 8 104485446 missense possibly damaging 0.65
R6473:Terb1 UTSW 8 104473037 missense probably damaging 1.00
R6701:Terb1 UTSW 8 104472756 missense possibly damaging 0.69
R7013:Terb1 UTSW 8 104488590 nonsense probably null
R7064:Terb1 UTSW 8 104488554 missense probably benign 0.00
R7237:Terb1 UTSW 8 104495327 missense possibly damaging 0.85
R7361:Terb1 UTSW 8 104468799 missense probably damaging 1.00
R7549:Terb1 UTSW 8 104498084 missense possibly damaging 0.85
R7915:Terb1 UTSW 8 104447216 missense possibly damaging 0.59
R8112:Terb1 UTSW 8 104468767 missense probably benign 0.32
R8256:Terb1 UTSW 8 104472947 missense possibly damaging 0.92
R8329:Terb1 UTSW 8 104484371 missense probably damaging 1.00
R8807:Terb1 UTSW 8 104469109 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTGAGACTATAGGTGTGTGCTACCA -3'
(R):5'- TGCACTGACTTGGAGTAGCCCTT -3'

Sequencing Primer
(F):5'- ATAGGTGTGTGCTACCATGCTAAG -3'
(R):5'- cgtcctgccttcctgcc -3'
Posted On2013-11-08