Incidental Mutation 'R0906:Terb1'
ID 83325
Institutional Source Beutler Lab
Gene Symbol Terb1
Ensembl Gene ENSMUSG00000052616
Gene Name telomere repeat binding bouquet formation protein 1
Synonyms Ccdc79, 4930532D21Rik
MMRRC Submission 039064-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0906 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105173351-105236542 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105179268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 640 (I640N)
Ref Sequence ENSEMBL: ENSMUSP00000067324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064576] [ENSMUST00000159713] [ENSMUST00000161520]
AlphaFold Q8C0V1
PDB Structure Solution structures of the myb-like DNA binding domain of 4930532D21Rik protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000064576
AA Change: I640N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067324
Gene: ENSMUSG00000052616
AA Change: I640N

DomainStartEndE-ValueType
SCOP:d1ee4a_ 2 368 7e-11 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
SANT 711 762 7.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159713
SMART Domains Protein: ENSMUSP00000124706
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 335 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161520
SMART Domains Protein: ENSMUSP00000125431
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 336 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162014
SMART Domains Protein: ENSMUSP00000123925
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1jdha_ 21 370 7e-8 SMART
low complexity region 382 394 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
low complexity region 688 695 N/A INTRINSIC
Meta Mutation Damage Score 0.1477 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Male and female mice homozygous for a null allele are infertile with arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,665,430 (GRCm39) probably benign Het
Atp7b T C 8: 22,517,842 (GRCm39) H332R probably benign Het
Bace2 C T 16: 97,158,141 (GRCm39) P47L possibly damaging Het
Cyp2c39 A G 19: 39,499,315 (GRCm39) M1V probably null Het
Dcbld2 A G 16: 58,275,610 (GRCm39) E442G probably damaging Het
Gm14496 A G 2: 181,642,308 (GRCm39) T660A probably damaging Het
Gm4945 A C 17: 47,353,796 (GRCm39) noncoding transcript Het
Gm6729 T C 10: 86,376,456 (GRCm39) noncoding transcript Het
Golga1 G A 2: 38,937,655 (GRCm39) R204W probably damaging Het
Guf1 T C 5: 69,723,729 (GRCm39) I348T probably damaging Het
Htra4 T A 8: 25,527,160 (GRCm39) I212L probably benign Het
Itih5 G A 2: 10,253,999 (GRCm39) R750Q probably benign Het
Lgalsl2 T C 7: 5,362,828 (GRCm39) I153T probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nsd1 T C 13: 55,425,403 (GRCm39) V1520A probably benign Het
Nuak1 C T 10: 84,211,144 (GRCm39) V315I probably damaging Het
Nup205 G T 6: 35,213,827 (GRCm39) G1740C probably damaging Het
Or1r1 G C 11: 73,874,685 (GRCm39) L250V probably damaging Het
Pclo T C 5: 14,726,700 (GRCm39) probably benign Het
Pik3r6 T C 11: 68,426,927 (GRCm39) probably benign Het
Pikfyve T A 1: 65,292,556 (GRCm39) F1336I probably damaging Het
Pla2r1 A G 2: 60,345,291 (GRCm39) I355T possibly damaging Het
Rgs22 A T 15: 36,104,048 (GRCm39) probably benign Het
Sec63 T A 10: 42,677,924 (GRCm39) M312K probably damaging Het
Slc2a5 T C 4: 150,227,287 (GRCm39) I401T probably benign Het
Slc9a8 G T 2: 167,276,787 (GRCm39) probably benign Het
Stab1 T C 14: 30,867,206 (GRCm39) E1718G probably benign Het
Tmem217 A G 17: 29,745,490 (GRCm39) L80P probably damaging Het
Topbp1 C T 9: 103,205,792 (GRCm39) P810L probably benign Het
Ttbk2 G A 2: 120,614,262 (GRCm39) R151C probably damaging Het
Vmn2r88 T G 14: 51,655,666 (GRCm39) L626R probably damaging Het
Other mutations in Terb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Terb1 APN 8 105,178,439 (GRCm39) missense probably benign 0.09
IGL01468:Terb1 APN 8 105,208,799 (GRCm39) intron probably benign
IGL01619:Terb1 APN 8 105,199,646 (GRCm39) missense probably benign 0.00
IGL01631:Terb1 APN 8 105,199,496 (GRCm39) missense probably damaging 0.99
IGL02041:Terb1 APN 8 105,221,746 (GRCm39) missense probably damaging 1.00
IGL02413:Terb1 APN 8 105,221,500 (GRCm39) critical splice donor site probably null
IGL02974:Terb1 APN 8 105,221,600 (GRCm39) nonsense probably null
IGL03091:Terb1 APN 8 105,195,786 (GRCm39) missense probably benign 0.03
IGL03410:Terb1 APN 8 105,199,674 (GRCm39) splice site probably benign
R0825:Terb1 UTSW 8 105,195,380 (GRCm39) missense possibly damaging 0.65
R1175:Terb1 UTSW 8 105,210,938 (GRCm39) missense probably benign 0.07
R1494:Terb1 UTSW 8 105,225,122 (GRCm39) splice site probably benign
R1657:Terb1 UTSW 8 105,215,123 (GRCm39) missense possibly damaging 0.77
R2018:Terb1 UTSW 8 105,179,331 (GRCm39) missense probably benign 0.00
R2029:Terb1 UTSW 8 105,224,732 (GRCm39) splice site probably benign
R2047:Terb1 UTSW 8 105,212,094 (GRCm39) missense probably damaging 1.00
R2062:Terb1 UTSW 8 105,195,380 (GRCm39) missense possibly damaging 0.65
R2179:Terb1 UTSW 8 105,199,369 (GRCm39) missense probably benign 0.08
R2179:Terb1 UTSW 8 105,179,347 (GRCm39) missense probably damaging 0.99
R2187:Terb1 UTSW 8 105,199,516 (GRCm39) missense probably benign
R2420:Terb1 UTSW 8 105,225,227 (GRCm39) missense probably damaging 1.00
R2867:Terb1 UTSW 8 105,174,485 (GRCm39) unclassified probably benign
R3749:Terb1 UTSW 8 105,223,466 (GRCm39) missense probably damaging 1.00
R4850:Terb1 UTSW 8 105,212,057 (GRCm39) missense probably benign 0.02
R4930:Terb1 UTSW 8 105,174,580 (GRCm39) missense probably benign 0.00
R4963:Terb1 UTSW 8 105,208,950 (GRCm39) missense probably damaging 1.00
R4969:Terb1 UTSW 8 105,221,795 (GRCm39) missense probably benign 0.00
R5100:Terb1 UTSW 8 105,221,805 (GRCm39) nonsense probably null
R5440:Terb1 UTSW 8 105,215,131 (GRCm39) missense probably damaging 1.00
R5824:Terb1 UTSW 8 105,212,079 (GRCm39) missense probably benign 0.08
R5950:Terb1 UTSW 8 105,215,117 (GRCm39) critical splice donor site probably null
R5985:Terb1 UTSW 8 105,208,948 (GRCm39) missense probably damaging 1.00
R5985:Terb1 UTSW 8 105,178,439 (GRCm39) missense probably benign 0.09
R6320:Terb1 UTSW 8 105,173,831 (GRCm39) missense probably damaging 1.00
R6432:Terb1 UTSW 8 105,212,078 (GRCm39) missense possibly damaging 0.65
R6473:Terb1 UTSW 8 105,199,669 (GRCm39) missense probably damaging 1.00
R6701:Terb1 UTSW 8 105,199,388 (GRCm39) missense possibly damaging 0.69
R7013:Terb1 UTSW 8 105,215,222 (GRCm39) nonsense probably null
R7064:Terb1 UTSW 8 105,215,186 (GRCm39) missense probably benign 0.00
R7237:Terb1 UTSW 8 105,221,959 (GRCm39) missense possibly damaging 0.85
R7361:Terb1 UTSW 8 105,195,431 (GRCm39) missense probably damaging 1.00
R7549:Terb1 UTSW 8 105,224,716 (GRCm39) missense possibly damaging 0.85
R7915:Terb1 UTSW 8 105,173,848 (GRCm39) missense possibly damaging 0.59
R8112:Terb1 UTSW 8 105,195,399 (GRCm39) missense probably benign 0.32
R8256:Terb1 UTSW 8 105,199,579 (GRCm39) missense possibly damaging 0.92
R8329:Terb1 UTSW 8 105,211,003 (GRCm39) missense probably damaging 1.00
R8807:Terb1 UTSW 8 105,195,741 (GRCm39) critical splice donor site probably null
R8953:Terb1 UTSW 8 105,195,431 (GRCm39) missense probably damaging 1.00
R8984:Terb1 UTSW 8 105,212,036 (GRCm39) missense possibly damaging 0.94
R9614:Terb1 UTSW 8 105,223,476 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GACTGAGACTATAGGTGTGTGCTACCA -3'
(R):5'- TGCACTGACTTGGAGTAGCCCTT -3'

Sequencing Primer
(F):5'- ATAGGTGTGTGCTACCATGCTAAG -3'
(R):5'- cgtcctgccttcctgcc -3'
Posted On 2013-11-08