Mutagenetix > Incidental Mutation

Incidental Mutation 'R0906:Topbp1'

83326

Institutional Source

Beutler Lab

Gene Symbol

Topbp1

Ensembl Gene

ENSMUSG00000032555

Gene Name

topoisomerase (DNA) II binding protein 1

Synonyms

D430026L04Rik, 2810429C13Rik, 1110031N14Rik

MMRRC Submission

039064-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0906 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103305215-103350428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 103328593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 810 (P810L)

Ref Sequence

ENSEMBL: ENSMUSP00000035164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035164]

AlphaFold

Q6ZQF0

Predicted Effect

probably benign
Transcript: ENSMUST00000035164
AA Change: P810L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555
AA Change: P810L

Domain	Start	End	E-Value	Type
BRCT	6	91	3.04e1	SMART
BRCT	103	179	1.51e-13	SMART
BRCT	197	274	4.69e-19	SMART
BRCT	355	433	3.58e-15	SMART
BRCT	553	626	5.57e-3	SMART
BRCT	646	731	1.53e-9	SMART
BRCT	904	983	3.48e-13	SMART
low complexity region	1097	1106	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1213	1218	N/A	INTRINSIC
BRCT	1258	1337	2.31e-9	SMART
Blast:BRCT	1387	1472	4e-52	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185721

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188840

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	T	A	1: 130,737,693		probably benign	Het
Atp7b	T	C	8: 22,027,826	H332R	probably benign	Het
Bace2	C	T	16: 97,356,941	P47L	possibly damaging	Het
Cyp2c39	A	G	19: 39,510,871	M1V	probably null	Het
Dcbld2	A	G	16: 58,455,247	E442G	probably damaging	Het
Gm14496	A	G	2: 182,000,515	T660A	probably damaging	Het
Gm4945	A	C	17: 47,042,870		noncoding transcript	Het
Gm5065	T	C	7: 5,359,829	I153T	probably damaging	Het
Gm6729	T	C	10: 86,540,592		noncoding transcript	Het
Golga1	G	A	2: 39,047,643	R204W	probably damaging	Het
Guf1	T	C	5: 69,566,386	I348T	probably damaging	Het
Htra4	T	A	8: 25,037,144	I212L	probably benign	Het
Itih5	G	A	2: 10,249,188	R750Q	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nsd1	T	C	13: 55,277,590	V1520A	probably benign	Het
Nuak1	C	T	10: 84,375,280	V315I	probably damaging	Het
Nup205	G	T	6: 35,236,892	G1740C	probably damaging	Het
Olfr398	G	C	11: 73,983,859	L250V	probably damaging	Het
Pclo	T	C	5: 14,676,686		probably benign	Het
Pik3r6	T	C	11: 68,536,101		probably benign	Het
Pikfyve	T	A	1: 65,253,397	F1336I	probably damaging	Het
Pla2r1	A	G	2: 60,514,947	I355T	possibly damaging	Het
Rgs22	A	T	15: 36,103,902		probably benign	Het
Sec63	T	A	10: 42,801,928	M312K	probably damaging	Het
Slc2a5	T	C	4: 150,142,830	I401T	probably benign	Het
Slc9a8	G	T	2: 167,434,867		probably benign	Het
Stab1	T	C	14: 31,145,249	E1718G	probably benign	Het
Terb1	A	T	8: 104,452,636	I640N	probably damaging	Het
Tmem217	A	G	17: 29,526,516	L80P	probably damaging	Het
Ttbk2	G	A	2: 120,783,781	R151C	probably damaging	Het
Vmn2r88	T	G	14: 51,418,209	L626R	probably damaging	Het

Other mutations in Topbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Topbp1	APN	9	103344943	missense	probably benign
IGL01524:Topbp1	APN	9	103311645	missense	possibly damaging	0.92
IGL02335:Topbp1	APN	9	103328523	missense	probably damaging	1.00
IGL02441:Topbp1	APN	9	103320239	missense	possibly damaging	0.49
IGL02943:Topbp1	APN	9	103328440	missense	probably benign	0.00
IGL02953:Topbp1	APN	9	103328435	missense	probably benign	0.26
IGL03040:Topbp1	APN	9	103328667	missense	possibly damaging	0.51
PIT4377001:Topbp1	UTSW	9	103309889	missense	possibly damaging	0.90
R0044:Topbp1	UTSW	9	103325773	missense	possibly damaging	0.94
R0344:Topbp1	UTSW	9	103328687	missense	probably damaging	0.99
R0344:Topbp1	UTSW	9	103308733	splice site	probably benign
R0591:Topbp1	UTSW	9	103349838	missense	probably benign	0.01
R0666:Topbp1	UTSW	9	103308812	missense	probably benign
R0785:Topbp1	UTSW	9	103315090	missense	probably damaging	1.00
R1352:Topbp1	UTSW	9	103347008	missense	probably benign
R1745:Topbp1	UTSW	9	103308845	missense	probably benign	0.36
R2104:Topbp1	UTSW	9	103317982	splice site	probably benign
R2166:Topbp1	UTSW	9	103312929	splice site	probably null
R2230:Topbp1	UTSW	9	103345848	missense	probably damaging	1.00
R2967:Topbp1	UTSW	9	103342140	missense	probably benign	0.01
R3845:Topbp1	UTSW	9	103309923	missense	possibly damaging	0.87
R4089:Topbp1	UTSW	9	103324501	critical splice donor site	probably null
R4110:Topbp1	UTSW	9	103309959	missense	probably damaging	0.98
R4454:Topbp1	UTSW	9	103344871	missense	probably damaging	1.00
R4521:Topbp1	UTSW	9	103334202	intron	probably benign
R4745:Topbp1	UTSW	9	103323571	missense	probably damaging	1.00
R4923:Topbp1	UTSW	9	103312836	missense	probably benign	0.00
R4934:Topbp1	UTSW	9	103328369	unclassified	probably benign
R4963:Topbp1	UTSW	9	103320605	missense	probably benign	0.04
R5199:Topbp1	UTSW	9	103346672	unclassified	probably benign
R5461:Topbp1	UTSW	9	103315196	missense	probably benign	0.00
R5517:Topbp1	UTSW	9	103336114	missense	probably benign	0.03
R5563:Topbp1	UTSW	9	103311513	missense	possibly damaging	0.46
R5564:Topbp1	UTSW	9	103334078	missense	probably damaging	1.00
R5683:Topbp1	UTSW	9	103312804	missense	possibly damaging	0.93
R5774:Topbp1	UTSW	9	103328499	missense	probably benign	0.06
R5785:Topbp1	UTSW	9	103323528	missense	probably benign	0.00
R6029:Topbp1	UTSW	9	103344953	missense	probably benign	0.00
R6077:Topbp1	UTSW	9	103332990	missense	probably damaging	1.00
R6122:Topbp1	UTSW	9	103346961	missense	probably benign	0.06
R6133:Topbp1	UTSW	9	103311764	splice site	probably null
R6213:Topbp1	UTSW	9	103332751	missense	probably benign	0.12
R6773:Topbp1	UTSW	9	103343692	missense	possibly damaging	0.90
R6922:Topbp1	UTSW	9	103335846	missense	probably damaging	1.00
R6938:Topbp1	UTSW	9	103328554	missense	probably damaging	1.00
R7305:Topbp1	UTSW	9	103328637	missense	probably damaging	1.00
R7419:Topbp1	UTSW	9	103323344	missense	probably benign
R7517:Topbp1	UTSW	9	103332733	missense	possibly damaging	0.82
R7605:Topbp1	UTSW	9	103332706	missense	probably benign	0.41
R7701:Topbp1	UTSW	9	103332985	missense	probably damaging	0.96
R7741:Topbp1	UTSW	9	103320557	missense	probably damaging	0.97
R8115:Topbp1	UTSW	9	103320541	missense	probably benign
R8177:Topbp1	UTSW	9	103320541	missense	probably benign	0.01
R8269:Topbp1	UTSW	9	103328593	missense	possibly damaging	0.67
R8446:Topbp1	UTSW	9	103308862	missense	probably damaging	1.00
R8520:Topbp1	UTSW	9	103308977	splice site	probably null
R8547:Topbp1	UTSW	9	103336065	missense	probably benign	0.00
R8549:Topbp1	UTSW	9	103324378	missense	probably damaging	1.00
R9003:Topbp1	UTSW	9	103323528	missense	probably benign	0.00
R9006:Topbp1	UTSW	9	103305300	unclassified	probably benign
R9163:Topbp1	UTSW	9	103328568	missense	probably benign
R9584:Topbp1	UTSW	9	103342043	missense	not run

Predicted Primers

PCR Primer
(F):5'- TCTCTGAAGCCACACTTGAAGAACAC -3'
(R):5'- CGCCCATTTATCAACATCTCTGGATGAC -3'

Sequencing Primer
(F):5'- gcagtgtcagtcaacaggttc -3'
(R):5'- TTAGTAGTAACGCACAATTTGGGG -3'

Posted On

2013-11-08