Incidental Mutation 'R0906:Sec63'
ID 83327
Institutional Source Beutler Lab
Gene Symbol Sec63
Ensembl Gene ENSMUSG00000019802
Gene Name SEC63-like (S. cerevisiae)
Synonyms
MMRRC Submission 039064-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0906 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 42761496-42832514 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42801928 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 312 (M312K)
Ref Sequence ENSEMBL: ENSMUSP00000019937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019937]
AlphaFold Q8VHE0
Predicted Effect probably damaging
Transcript: ENSMUST00000019937
AA Change: M312K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019937
Gene: ENSMUSG00000019802
AA Change: M312K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
DnaJ 103 157 6.14e-23 SMART
Blast:Sec63 170 208 9e-6 BLAST
Sec63 219 714 6.98e-10 SMART
low complexity region 734 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155410
Meta Mutation Damage Score 0.2218 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Sec63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Sec63 APN 10 42812457 missense possibly damaging 0.56
IGL02111:Sec63 APN 10 42810888 missense probably damaging 1.00
IGL02457:Sec63 APN 10 42801733 splice site probably benign
IGL02613:Sec63 APN 10 42801707 missense probably damaging 1.00
IGL03002:Sec63 APN 10 42810909 missense possibly damaging 0.51
IGL03493:Sec63 APN 10 42828941 missense probably benign 0.06
cyst UTSW 10 42828865 splice site probably null
stillwater UTSW 10 42803905 missense probably damaging 1.00
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0538:Sec63 UTSW 10 42798799 missense probably benign 0.01
R0734:Sec63 UTSW 10 42796208 missense probably benign 0.08
R1136:Sec63 UTSW 10 42806546 missense probably damaging 1.00
R1665:Sec63 UTSW 10 42798728 splice site probably null
R1736:Sec63 UTSW 10 42827918 nonsense probably null
R1961:Sec63 UTSW 10 42823886 missense probably damaging 1.00
R2696:Sec63 UTSW 10 42783526 missense probably benign 0.05
R4886:Sec63 UTSW 10 42789393 nonsense probably null
R4908:Sec63 UTSW 10 42805190 missense probably damaging 0.99
R5174:Sec63 UTSW 10 42829081 utr 3 prime probably benign
R5619:Sec63 UTSW 10 42789382 missense probably damaging 1.00
R5766:Sec63 UTSW 10 42801681 missense probably damaging 0.99
R5820:Sec63 UTSW 10 42796245 missense possibly damaging 0.49
R6232:Sec63 UTSW 10 42828865 splice site probably null
R6656:Sec63 UTSW 10 42816383 nonsense probably null
R6847:Sec63 UTSW 10 42791253 missense probably damaging 1.00
R6971:Sec63 UTSW 10 42783442 missense probably damaging 1.00
R8037:Sec63 UTSW 10 42783487 missense probably benign 0.00
R8529:Sec63 UTSW 10 42789383 missense probably damaging 1.00
R8756:Sec63 UTSW 10 42810909 missense possibly damaging 0.51
R9259:Sec63 UTSW 10 42823941 missense probably benign 0.11
R9391:Sec63 UTSW 10 42805105 missense probably benign 0.01
R9419:Sec63 UTSW 10 42803905 missense probably damaging 1.00
R9760:Sec63 UTSW 10 42828948 missense probably benign 0.00
RF010:Sec63 UTSW 10 42806624 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATTCCACAAGCAGGCCAACAGATAATA -3'
(R):5'- AACGCTTCTGCTAACCTGCAACT -3'

Sequencing Primer
(F):5'- ATACCACAGGTTAGGCTCATCTTAC -3'
(R):5'- GCTTCGGTCCCTTAAAACCCTT -3'
Posted On 2013-11-08