Incidental Mutation 'R0906:Gm6729'
ID83329
Institutional Source Beutler Lab
Gene Symbol Gm6729
Ensembl Gene ENSMUSG00000090816
Gene Namepredicted gene 6729
Synonyms
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86539883-86541334 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 86540592 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165173
SMART Domains Protein: ENSMUSP00000133178
Gene: ENSMUSG00000090816

DomainStartEndE-ValueType
S_TKc 14 262 4.3e-87 SMART
UBA 276 313 2.99e-4 SMART
low complexity region 327 341 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219485
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Gm6729
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1034:Gm6729 UTSW 10 86540026 unclassified noncoding transcript
R1052:Gm6729 UTSW 10 86540935 unclassified noncoding transcript
R1523:Gm6729 UTSW 10 86540175 unclassified noncoding transcript
R1922:Gm6729 UTSW 10 86540918 unclassified noncoding transcript
R3498:Gm6729 UTSW 10 86540718 unclassified noncoding transcript
R4133:Gm6729 UTSW 10 86541166 unclassified noncoding transcript
R4193:Gm6729 UTSW 10 86540619 unclassified noncoding transcript
R4940:Gm6729 UTSW 10 86540388 unclassified noncoding transcript
X0028:Gm6729 UTSW 10 86540784 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCAACTTGTGTCCTGATAGTGGCAG -3'
(R):5'- TCAAGCTCAGCCCTGGCAGATTAC -3'

Sequencing Primer
(F):5'- CCAAAGTTGGGTTCACTGC -3'
(R):5'- TCATGCTAGGGGAGCCATAC -3'
Posted On2013-11-08