Incidental Mutation 'R0906:Olfr398'
ID83331
Institutional Source Beutler Lab
Gene Symbol Olfr398
Ensembl Gene ENSMUSG00000049041
Gene Nameolfactory receptor 398
SynonymsGA_x6K02T2P1NL-4141430-4140486, MOR157-1
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73979967-73990407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 73983859 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 250 (L250V)
Ref Sequence ENSEMBL: ENSMUSP00000149170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053874] [ENSMUST00000117510] [ENSMUST00000214334]
Predicted Effect probably damaging
Transcript: ENSMUST00000053874
AA Change: L250V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059548
Gene: ENSMUSG00000049041
AA Change: L250V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117510
AA Change: L250V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113005
Gene: ENSMUSG00000049041
AA Change: L250V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 6.4e-28 PFAM
Pfam:7tm_4 140 283 4.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214334
AA Change: L250V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.3510 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Bace2 C T 16: 97,356,941 P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Olfr398
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr398 APN 11 73984527 missense probably damaging 1.00
IGL01116:Olfr398 APN 11 73984318 missense probably damaging 1.00
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0647:Olfr398 UTSW 11 73983771 missense probably damaging 0.99
R1581:Olfr398 UTSW 11 73984521 missense probably damaging 1.00
R1792:Olfr398 UTSW 11 73983847 missense probably benign 0.34
R1832:Olfr398 UTSW 11 73984493 missense probably damaging 0.98
R1879:Olfr398 UTSW 11 73984542 missense probably benign 0.00
R2138:Olfr398 UTSW 11 73984303 missense probably damaging 1.00
R2988:Olfr398 UTSW 11 73983801 missense probably benign 0.13
R4557:Olfr398 UTSW 11 73984599 missense probably benign 0.25
R4606:Olfr398 UTSW 11 73983892 missense probably damaging 1.00
R4777:Olfr398 UTSW 11 73984395 missense probably benign 0.01
R4783:Olfr398 UTSW 11 73984008 missense probably damaging 0.97
R5047:Olfr398 UTSW 11 73984378 missense probably damaging 1.00
R5696:Olfr398 UTSW 11 73984536 missense possibly damaging 0.90
R6379:Olfr398 UTSW 11 73984273 missense probably damaging 1.00
R7166:Olfr398 UTSW 11 73984295 missense possibly damaging 0.81
R7254:Olfr398 UTSW 11 73983777 missense probably benign 0.40
R7324:Olfr398 UTSW 11 73983843 missense probably benign 0.06
R7444:Olfr398 UTSW 11 73983750 missense probably damaging 1.00
R7831:Olfr398 UTSW 11 73984431 missense probably damaging 1.00
R7914:Olfr398 UTSW 11 73984431 missense probably damaging 1.00
X0012:Olfr398 UTSW 11 73984294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGACATGCCAGTTAACCCAGACC -3'
(R):5'- TGGCAACCTCTGACACATCAGC -3'

Sequencing Primer
(F):5'- GTGCTGCTCTCCATCTGAAAC -3'
(R):5'- TAACAGTGGTGTTGACCCCT -3'
Posted On2013-11-08