Mutagenetix > Incidental Mutation

Incidental Mutation 'R0906:Vmn2r88'

83336

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r88

Ensembl Gene

ENSMUSG00000000606

Gene Name

vomeronasal 2, receptor 88

Synonyms

V2r3, V2r13

MMRRC Submission

039064-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R0906 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51410819-51419527 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 51418209 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 626 (L626R)

Ref Sequence

ENSEMBL: ENSMUSP00000154310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]

AlphaFold

L7N1W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000022438
AA Change: L634R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: L634R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:ANF_receptor	76	457	8.3e-27	PFAM
Pfam:NCD3G	516	570	1.2e-18	PFAM
Pfam:7tm_3	603	838	1.9e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159674
AA Change: L625R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: L625R

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	30	408	3.2e-30	PFAM
Pfam:NCD3G	463	516	1.2e-19	PFAM
Pfam:7tm_3	546	785	3.7e-81	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161565

Predicted Effect

probably benign
Transcript: ENSMUST00000162998

SMART Domains

Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

Domain	Start	End	E-Value	Type
Pfam:Takusan	35	115	2.2e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163019

SMART Domains

Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	52	399	3.7e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000228139
AA Change: L626R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.3%

Validation Efficiency

100% (33/33)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	T	A	1: 130,737,693		probably benign	Het
Atp7b	T	C	8: 22,027,826	H332R	probably benign	Het
Bace2	C	T	16: 97,356,941	P47L	possibly damaging	Het
Cyp2c39	A	G	19: 39,510,871	M1V	probably null	Het
Dcbld2	A	G	16: 58,455,247	E442G	probably damaging	Het
Gm14496	A	G	2: 182,000,515	T660A	probably damaging	Het
Gm4945	A	C	17: 47,042,870		noncoding transcript	Het
Gm5065	T	C	7: 5,359,829	I153T	probably damaging	Het
Gm6729	T	C	10: 86,540,592		noncoding transcript	Het
Golga1	G	A	2: 39,047,643	R204W	probably damaging	Het
Guf1	T	C	5: 69,566,386	I348T	probably damaging	Het
Htra4	T	A	8: 25,037,144	I212L	probably benign	Het
Itih5	G	A	2: 10,249,188	R750Q	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nsd1	T	C	13: 55,277,590	V1520A	probably benign	Het
Nuak1	C	T	10: 84,375,280	V315I	probably damaging	Het
Nup205	G	T	6: 35,236,892	G1740C	probably damaging	Het
Olfr398	G	C	11: 73,983,859	L250V	probably damaging	Het
Pclo	T	C	5: 14,676,686		probably benign	Het
Pik3r6	T	C	11: 68,536,101		probably benign	Het
Pikfyve	T	A	1: 65,253,397	F1336I	probably damaging	Het
Pla2r1	A	G	2: 60,514,947	I355T	possibly damaging	Het
Rgs22	A	T	15: 36,103,902		probably benign	Het
Sec63	T	A	10: 42,801,928	M312K	probably damaging	Het
Slc2a5	T	C	4: 150,142,830	I401T	probably benign	Het
Slc9a8	G	T	2: 167,434,867		probably benign	Het
Stab1	T	C	14: 31,145,249	E1718G	probably benign	Het
Terb1	A	T	8: 104,452,636	I640N	probably damaging	Het
Tmem217	A	G	17: 29,526,516	L80P	probably damaging	Het
Topbp1	C	T	9: 103,328,593	P810L	probably benign	Het
Ttbk2	G	A	2: 120,783,781	R151C	probably damaging	Het

Other mutations in Vmn2r88

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r88	APN	14	51413125	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413060	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413256	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51416802	missense	possibly damaging	0.59
IGL02308:Vmn2r88	APN	14	51417980	missense	possibly damaging	0.96
IGL02481:Vmn2r88	APN	14	51414154	missense	probably benign
IGL02483:Vmn2r88	APN	14	51414154	missense	probably benign
IGL03241:Vmn2r88	APN	14	51418373	missense	probably benign	0.03
R0052:Vmn2r88	UTSW	14	51418700	missense	possibly damaging	0.88
R0070:Vmn2r88	UTSW	14	51414140	missense	probably benign	0.08
R0799:Vmn2r88	UTSW	14	51414502	missense	possibly damaging	0.61
R1322:Vmn2r88	UTSW	14	51414108	missense	probably damaging	1.00
R1352:Vmn2r88	UTSW	14	51418550	missense	probably damaging	1.00
R1639:Vmn2r88	UTSW	14	51416787	missense	probably damaging	0.98
R1780:Vmn2r88	UTSW	14	51418572	missense	probably damaging	1.00
R1834:Vmn2r88	UTSW	14	51413030	splice site	probably benign
R1911:Vmn2r88	UTSW	14	51418214	missense	probably damaging	1.00
R2113:Vmn2r88	UTSW	14	51418194	missense	probably damaging	1.00
R2120:Vmn2r88	UTSW	14	51413208	missense	probably benign	0.00
R2126:Vmn2r88	UTSW	14	51413807	missense	probably benign	0.01
R2348:Vmn2r88	UTSW	14	51414004	missense	probably benign	0.00
R2881:Vmn2r88	UTSW	14	51418689	missense	probably damaging	0.97
R2884:Vmn2r88	UTSW	14	51413934	missense	probably damaging	1.00
R3081:Vmn2r88	UTSW	14	51418632	missense	probably damaging	0.99
R3933:Vmn2r88	UTSW	14	51413978	missense	probably benign	0.44
R3967:Vmn2r88	UTSW	14	51413190	missense	probably benign	0.06
R4091:Vmn2r88	UTSW	14	51415426	missense	probably damaging	1.00
R4378:Vmn2r88	UTSW	14	51413289	nonsense	probably null
R4397:Vmn2r88	UTSW	14	51417978	missense	probably damaging	1.00
R4418:Vmn2r88	UTSW	14	51418081	missense	probably damaging	1.00
R4609:Vmn2r88	UTSW	14	51418074	missense	probably damaging	0.98
R4647:Vmn2r88	UTSW	14	51418793	missense	probably benign	0.02
R4672:Vmn2r88	UTSW	14	51418155	missense	probably damaging	1.00
R4684:Vmn2r88	UTSW	14	51413334	missense	possibly damaging	0.95
R4686:Vmn2r88	UTSW	14	51413339	missense	probably benign	0.03
R4720:Vmn2r88	UTSW	14	51413245	missense	probably benign	0.01
R5046:Vmn2r88	UTSW	14	51413181	missense	probably benign	0.03
R5063:Vmn2r88	UTSW	14	51411146	missense	probably damaging	0.96
R5619:Vmn2r88	UTSW	14	51413910	missense	probably damaging	0.99
R5652:Vmn2r88	UTSW	14	51418572	missense	probably damaging	0.98
R6020:Vmn2r88	UTSW	14	51418149	nonsense	probably null
R6103:Vmn2r88	UTSW	14	51415369	missense	probably benign	0.17
R6674:Vmn2r88	UTSW	14	51414338	missense	probably benign	0.01
R6799:Vmn2r88	UTSW	14	51413969	missense	probably benign	0.05
R7089:Vmn2r88	UTSW	14	51418643	missense
R7104:Vmn2r88	UTSW	14	51413796	missense
R7265:Vmn2r88	UTSW	14	51418319	missense
R7316:Vmn2r88	UTSW	14	51414255	missense
R7552:Vmn2r88	UTSW	14	51410858	splice site	probably null
R7611:Vmn2r88	UTSW	14	51413997	missense
R7667:Vmn2r88	UTSW	14	51417989	missense
R7682:Vmn2r88	UTSW	14	51418449	missense
R7755:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7811:Vmn2r88	UTSW	14	51418703	missense
R7882:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7957:Vmn2r88	UTSW	14	51413132	missense
R7998:Vmn2r88	UTSW	14	51414108	missense
R8142:Vmn2r88	UTSW	14	51414107	missense
R8186:Vmn2r88	UTSW	14	51418700	missense
R8348:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8448:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8483:Vmn2r88	UTSW	14	51413073	missense	possibly damaging	0.48
R8783:Vmn2r88	UTSW	14	51414066	missense
R8859:Vmn2r88	UTSW	14	51418806	missense	probably damaging	0.97
R8916:Vmn2r88	UTSW	14	51411136	missense
R8936:Vmn2r88	UTSW	14	51418526	missense	possibly damaging	0.88
R9004:Vmn2r88	UTSW	14	51413167	missense
R9038:Vmn2r88	UTSW	14	51414033	missense
R9063:Vmn2r88	UTSW	14	51410872	start gained	probably benign
R9311:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R9382:Vmn2r88	UTSW	14	51418740	missense
R9483:Vmn2r88	UTSW	14	51411184	missense
R9602:Vmn2r88	UTSW	14	51413732	missense
V5622:Vmn2r88	UTSW	14	51413127	missense	probably benign
X0024:Vmn2r88	UTSW	14	51413832	missense	possibly damaging	0.79
X0025:Vmn2r88	UTSW	14	51416802	missense	possibly damaging	0.59
Z1177:Vmn2r88	UTSW	14	51418046	frame shift	probably null
Z1177:Vmn2r88	UTSW	14	51418187	missense
Z1190:Vmn2r88	UTSW	14	51413201	missense

Predicted Primers

PCR Primer
(F):5'- TGCCAGCAGATATGGAACAGTGTG -3'
(R):5'- AGTAGTGAGCTTGAAAGCCATGACC -3'

Sequencing Primer
(F):5'- GAAGTGTCCATATGATAAGTATGCC -3'
(R):5'- GAAAGCCATGACCACAGTTATTG -3'

Posted On

2013-11-08