Incidental Mutation 'R0906:Dcbld2'
ID 83338
Institutional Source Beutler Lab
Gene Symbol Dcbld2
Ensembl Gene ENSMUSG00000035107
Gene Name discoidin, CUB and LCCL domain containing 2
Synonyms Esdn, 1700055P21Rik, CLCP1
MMRRC Submission 039064-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0906 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 58408443-58469727 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58455247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 442 (E442G)
Ref Sequence ENSEMBL: ENSMUSP00000039915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663]
AlphaFold Q91ZV3
Predicted Effect probably damaging
Transcript: ENSMUST00000046663
AA Change: E442G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107
AA Change: E442G

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150817
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced postnatal angiogenesis and impaired recovery from femoral artery ligation with impaired blood flow and decreased capillary density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 (GRCm38) probably benign Het
Atp7b T C 8: 22,027,826 (GRCm38) H332R probably benign Het
Bace2 C T 16: 97,356,941 (GRCm38) P47L possibly damaging Het
Cyp2c39 A G 19: 39,510,871 (GRCm38) M1V probably null Het
Gm14496 A G 2: 182,000,515 (GRCm38) T660A probably damaging Het
Gm4945 A C 17: 47,042,870 (GRCm38) noncoding transcript Het
Gm5065 T C 7: 5,359,829 (GRCm38) I153T probably damaging Het
Gm6729 T C 10: 86,540,592 (GRCm38) noncoding transcript Het
Golga1 G A 2: 39,047,643 (GRCm38) R204W probably damaging Het
Guf1 T C 5: 69,566,386 (GRCm38) I348T probably damaging Het
Htra4 T A 8: 25,037,144 (GRCm38) I212L probably benign Het
Itih5 G A 2: 10,249,188 (GRCm38) R750Q probably benign Het
Lgr6 C T 1: 134,994,010 (GRCm38) A199T probably damaging Het
Naip2 T C 13: 100,161,854 (GRCm38) E558G probably benign Het
Naip2 C T 13: 100,161,860 (GRCm38) G556D probably benign Het
Nsd1 T C 13: 55,277,590 (GRCm38) V1520A probably benign Het
Nuak1 C T 10: 84,375,280 (GRCm38) V315I probably damaging Het
Nup205 G T 6: 35,236,892 (GRCm38) G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 (GRCm38) L250V probably damaging Het
Pclo T C 5: 14,676,686 (GRCm38) probably benign Het
Pik3r6 T C 11: 68,536,101 (GRCm38) probably benign Het
Pikfyve T A 1: 65,253,397 (GRCm38) F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 (GRCm38) I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 (GRCm38) probably benign Het
Sec63 T A 10: 42,801,928 (GRCm38) M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 (GRCm38) I401T probably benign Het
Slc9a8 G T 2: 167,434,867 (GRCm38) probably benign Het
Stab1 T C 14: 31,145,249 (GRCm38) E1718G probably benign Het
Terb1 A T 8: 104,452,636 (GRCm38) I640N probably damaging Het
Tmem217 A G 17: 29,526,516 (GRCm38) L80P probably damaging Het
Topbp1 C T 9: 103,328,593 (GRCm38) P810L probably benign Het
Ttbk2 G A 2: 120,783,781 (GRCm38) R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 (GRCm38) L626R probably damaging Het
Other mutations in Dcbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Dcbld2 APN 16 58,408,873 (GRCm38) missense possibly damaging 0.75
IGL01978:Dcbld2 APN 16 58,464,319 (GRCm38) missense probably benign 0.00
IGL02143:Dcbld2 APN 16 58,448,526 (GRCm38) critical splice donor site probably null
IGL02953:Dcbld2 APN 16 58,451,737 (GRCm38) missense probably benign 0.29
IGL03109:Dcbld2 APN 16 58,456,402 (GRCm38) missense probably benign 0.06
IGL03131:Dcbld2 APN 16 58,451,688 (GRCm38) missense probably benign 0.00
R0183:Dcbld2 UTSW 16 58,445,359 (GRCm38) missense possibly damaging 0.70
R0305:Dcbld2 UTSW 16 58,448,939 (GRCm38) missense probably damaging 1.00
R0316:Dcbld2 UTSW 16 58,433,445 (GRCm38) missense probably damaging 1.00
R0371:Dcbld2 UTSW 16 58,450,823 (GRCm38) missense probably benign 0.09
R0548:Dcbld2 UTSW 16 58,455,145 (GRCm38) missense probably damaging 0.98
R0751:Dcbld2 UTSW 16 58,449,841 (GRCm38) critical splice donor site probably null
R1184:Dcbld2 UTSW 16 58,449,841 (GRCm38) critical splice donor site probably null
R1557:Dcbld2 UTSW 16 58,465,350 (GRCm38) missense possibly damaging 0.49
R1995:Dcbld2 UTSW 16 58,456,332 (GRCm38) missense probably benign
R3930:Dcbld2 UTSW 16 58,465,338 (GRCm38) missense probably damaging 1.00
R3931:Dcbld2 UTSW 16 58,465,338 (GRCm38) missense probably damaging 1.00
R4080:Dcbld2 UTSW 16 58,465,373 (GRCm38) missense probably damaging 1.00
R4385:Dcbld2 UTSW 16 58,463,066 (GRCm38) missense probably damaging 0.96
R4615:Dcbld2 UTSW 16 58,456,094 (GRCm38) missense probably benign 0.03
R4739:Dcbld2 UTSW 16 58,460,976 (GRCm38) missense probably damaging 1.00
R4963:Dcbld2 UTSW 16 58,465,782 (GRCm38) missense probably benign
R4968:Dcbld2 UTSW 16 58,424,711 (GRCm38) missense probably damaging 1.00
R5419:Dcbld2 UTSW 16 58,455,258 (GRCm38) missense probably damaging 0.99
R5684:Dcbld2 UTSW 16 58,449,809 (GRCm38) missense possibly damaging 0.90
R5737:Dcbld2 UTSW 16 58,460,985 (GRCm38) missense probably damaging 1.00
R6277:Dcbld2 UTSW 16 58,465,503 (GRCm38) missense probably damaging 1.00
R6277:Dcbld2 UTSW 16 58,451,756 (GRCm38) missense probably damaging 0.97
R6468:Dcbld2 UTSW 16 58,433,373 (GRCm38) nonsense probably null
R6753:Dcbld2 UTSW 16 58,456,130 (GRCm38) missense possibly damaging 0.94
R7213:Dcbld2 UTSW 16 58,450,763 (GRCm38) missense probably benign 0.02
R7360:Dcbld2 UTSW 16 58,465,320 (GRCm38) splice site probably null
R7555:Dcbld2 UTSW 16 58,448,718 (GRCm38) splice site probably null
R7570:Dcbld2 UTSW 16 58,424,569 (GRCm38) missense possibly damaging 0.86
R7593:Dcbld2 UTSW 16 58,424,578 (GRCm38) missense possibly damaging 0.82
R8072:Dcbld2 UTSW 16 58,463,097 (GRCm38) nonsense probably null
R8175:Dcbld2 UTSW 16 58,433,347 (GRCm38) missense possibly damaging 0.63
R8193:Dcbld2 UTSW 16 58,464,010 (GRCm38) splice site probably null
R8323:Dcbld2 UTSW 16 58,463,110 (GRCm38) critical splice donor site probably null
R8804:Dcbld2 UTSW 16 58,461,049 (GRCm38) critical splice donor site probably benign
R8887:Dcbld2 UTSW 16 58,408,907 (GRCm38) missense probably damaging 1.00
R8955:Dcbld2 UTSW 16 58,450,762 (GRCm38) missense
R8971:Dcbld2 UTSW 16 58,456,352 (GRCm38) missense probably benign
R9335:Dcbld2 UTSW 16 58,451,778 (GRCm38) missense probably benign 0.01
R9384:Dcbld2 UTSW 16 58,465,563 (GRCm38) missense probably damaging 1.00
R9496:Dcbld2 UTSW 16 58,450,801 (GRCm38) missense probably benign 0.00
R9517:Dcbld2 UTSW 16 58,433,456 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACATGCTTAGCTGGAGCAGTC -3'
(R):5'- AGAGCCAACTATGTCTGGCACAATG -3'

Sequencing Primer
(F):5'- GAGCAGTCTAGTTCTGGTCTC -3'
(R):5'- gagagaggactttgaaaagtgtc -3'
Posted On 2013-11-08