Incidental Mutation 'R0906:Bace2'
ID83339
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Namebeta-site APP-cleaving enzyme 2
Synonyms1110059C24Rik, ARP1, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 039064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0906 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97356742-97442936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97356941 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 47 (P47L)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047275
AA Change: P47L

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: P47L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Meta Mutation Damage Score 0.1080 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,737,693 probably benign Het
Atp7b T C 8: 22,027,826 H332R probably benign Het
Cyp2c39 A G 19: 39,510,871 M1V probably null Het
Dcbld2 A G 16: 58,455,247 E442G probably damaging Het
Gm14496 A G 2: 182,000,515 T660A probably damaging Het
Gm4945 A C 17: 47,042,870 noncoding transcript Het
Gm5065 T C 7: 5,359,829 I153T probably damaging Het
Gm6729 T C 10: 86,540,592 noncoding transcript Het
Golga1 G A 2: 39,047,643 R204W probably damaging Het
Guf1 T C 5: 69,566,386 I348T probably damaging Het
Htra4 T A 8: 25,037,144 I212L probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nsd1 T C 13: 55,277,590 V1520A probably benign Het
Nuak1 C T 10: 84,375,280 V315I probably damaging Het
Nup205 G T 6: 35,236,892 G1740C probably damaging Het
Olfr398 G C 11: 73,983,859 L250V probably damaging Het
Pclo T C 5: 14,676,686 probably benign Het
Pik3r6 T C 11: 68,536,101 probably benign Het
Pikfyve T A 1: 65,253,397 F1336I probably damaging Het
Pla2r1 A G 2: 60,514,947 I355T possibly damaging Het
Rgs22 A T 15: 36,103,902 probably benign Het
Sec63 T A 10: 42,801,928 M312K probably damaging Het
Slc2a5 T C 4: 150,142,830 I401T probably benign Het
Slc9a8 G T 2: 167,434,867 probably benign Het
Stab1 T C 14: 31,145,249 E1718G probably benign Het
Terb1 A T 8: 104,452,636 I640N probably damaging Het
Tmem217 A G 17: 29,526,516 L80P probably damaging Het
Topbp1 C T 9: 103,328,593 P810L probably benign Het
Ttbk2 G A 2: 120,783,781 R151C probably damaging Het
Vmn2r88 T G 14: 51,418,209 L626R probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97408430 missense probably damaging 0.97
IGL02660:Bace2 APN 16 97415140 missense probably damaging 1.00
IGL02669:Bace2 APN 16 97436893 makesense probably null
R0244:Bace2 UTSW 16 97436773 splice site probably null
R0674:Bace2 UTSW 16 97436749 missense possibly damaging 0.93
R1078:Bace2 UTSW 16 97356860 missense unknown
R1670:Bace2 UTSW 16 97412135 missense probably damaging 0.96
R1997:Bace2 UTSW 16 97415089 missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97412136 missense probably damaging 1.00
R2937:Bace2 UTSW 16 97412188 critical splice donor site probably null
R2938:Bace2 UTSW 16 97412188 critical splice donor site probably null
R3103:Bace2 UTSW 16 97422001 critical splice donor site probably null
R3755:Bace2 UTSW 16 97436657 missense probably benign 0.34
R4110:Bace2 UTSW 16 97436656 missense probably benign
R4112:Bace2 UTSW 16 97436656 missense probably benign
R4113:Bace2 UTSW 16 97436656 missense probably benign
R4560:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4562:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4563:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4717:Bace2 UTSW 16 97436873 missense probably damaging 1.00
R5535:Bace2 UTSW 16 97413425 missense probably damaging 1.00
R6282:Bace2 UTSW 16 97415097 missense probably damaging 1.00
R6364:Bace2 UTSW 16 97413433 missense probably benign 0.05
R7045:Bace2 UTSW 16 97399665 missense probably damaging 1.00
R7241:Bace2 UTSW 16 97436798 missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97399682 missense probably benign 0.01
R7653:Bace2 UTSW 16 97436652 missense
R8026:Bace2 UTSW 16 97436852 missense probably benign 0.26
R8171:Bace2 UTSW 16 97424586 missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97413470 missense probably damaging 1.00
X0024:Bace2 UTSW 16 97413398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACTTGTTCAACTCTGCACCG -3'
(R):5'- CTTCTTCCCAGTGAAAGCTACTGCC -3'

Sequencing Primer
(F):5'- GGCTAAGGACCGCAGAACC -3'
(R):5'- CTTAGGGACGGCATTAAATCGC -3'
Posted On2013-11-08