Incidental Mutation 'R0907:Gucy1a1'
ID83347
Institutional Source Beutler Lab
Gene Symbol Gucy1a1
Ensembl Gene ENSMUSG00000033910
Gene Nameguanylate cyclase 1, soluble, alpha 1
SynonymssGC-alpha1, alpha 1 sGC, 1200016O07Rik
MMRRC Submission 039065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0907 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location82092427-82145789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82111191 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000142138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]
Predicted Effect probably benign
Transcript: ENSMUST00000048976
AA Change: D113G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: D113G

DomainStartEndE-ValueType
Pfam:HNOB 85 235 2.5e-8 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191942
Predicted Effect probably benign
Transcript: ENSMUST00000193924
AA Change: D113G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: D113G

DomainStartEndE-ValueType
Pfam:HNOB 73 237 1.6e-7 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 V225M probably damaging Het
Afmid T A 11: 117,835,590 probably benign Het
Ccdc191 G A 16: 43,915,538 V216I probably benign Het
Cep112 C A 11: 108,570,432 probably benign Het
Dcbld1 T C 10: 52,261,814 V58A possibly damaging Het
Dopey2 A T 16: 93,801,593 H1882L probably damaging Het
Fat1 A G 8: 45,026,598 I2894V probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gm45713 G A 7: 45,132,364 T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 Y28C probably damaging Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Herc1 C A 9: 66,433,428 F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 E270G probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp3 A T 7: 35,203,293 Y522N probably damaging Het
Lrp6 A T 6: 134,507,525 D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 N351S probably benign Het
Olfr1 A T 11: 73,395,119 L301Q probably damaging Het
Olfr1500 T C 19: 13,827,856 D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Qdpr G C 5: 45,439,386 I145M probably benign Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rd3l G T 12: 111,980,140 Y1* probably null Het
Sf3b3 A G 8: 110,811,510 probably benign Het
Smn1 C T 13: 100,127,896 T45I probably damaging Het
Sprr3 A T 3: 92,457,009 I176N probably benign Het
Sv2c T C 13: 96,088,255 D182G probably damaging Het
Tnni3k A T 3: 154,941,679 V397D probably damaging Het
Trpt1 G T 19: 6,998,940 G235V possibly damaging Het
Ttll10 A T 4: 156,036,164 C367* probably null Het
Unc5c A G 3: 141,789,033 Q369R probably damaging Het
Other mutations in Gucy1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Gucy1a1 APN 3 82111191 missense probably benign 0.00
IGL01626:Gucy1a1 APN 3 82108619 missense probably damaging 1.00
IGL01662:Gucy1a1 APN 3 82109253 missense possibly damaging 0.63
IGL02480:Gucy1a1 APN 3 82097733 missense probably damaging 1.00
IGL02902:Gucy1a1 APN 3 82118917 missense possibly damaging 0.87
IGL03022:Gucy1a1 APN 3 82109097 missense probably benign 0.30
IGL03056:Gucy1a1 APN 3 82113287 missense probably benign 0.00
IGL03089:Gucy1a1 APN 3 82097681 missense probably damaging 1.00
IGL03226:Gucy1a1 APN 3 82119024 missense probably benign 0.00
IGL03377:Gucy1a1 APN 3 82106015 missense probably damaging 1.00
R0245:Gucy1a1 UTSW 3 82108787 missense possibly damaging 0.67
R0762:Gucy1a1 UTSW 3 82094896 missense unknown
R1242:Gucy1a1 UTSW 3 82105953 splice site probably null
R1625:Gucy1a1 UTSW 3 82102055 missense probably benign 0.02
R1671:Gucy1a1 UTSW 3 82106222 missense probably damaging 1.00
R2056:Gucy1a1 UTSW 3 82109285 missense possibly damaging 0.89
R2094:Gucy1a1 UTSW 3 82113332 missense probably benign
R2140:Gucy1a1 UTSW 3 82118886 splice site probably null
R2154:Gucy1a1 UTSW 3 82111151 critical splice donor site probably null
R3418:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R3419:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R4290:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4291:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4292:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4294:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4573:Gucy1a1 UTSW 3 82108922 missense possibly damaging 0.95
R4629:Gucy1a1 UTSW 3 82097624 missense probably damaging 1.00
R4755:Gucy1a1 UTSW 3 82094795 missense probably benign 0.40
R4865:Gucy1a1 UTSW 3 82119162 utr 5 prime probably benign
R5528:Gucy1a1 UTSW 3 82109073 missense probably damaging 1.00
R5933:Gucy1a1 UTSW 3 82094807 missense probably damaging 0.96
R6278:Gucy1a1 UTSW 3 82097634 missense probably damaging 1.00
R6385:Gucy1a1 UTSW 3 82109006 missense probably benign
R7011:Gucy1a1 UTSW 3 82109115 missense probably damaging 1.00
R7361:Gucy1a1 UTSW 3 82097720 missense probably damaging 1.00
R7648:Gucy1a1 UTSW 3 82108707 missense possibly damaging 0.63
R7709:Gucy1a1 UTSW 3 82094789 missense unknown
R7770:Gucy1a1 UTSW 3 82108805 missense possibly damaging 0.95
R8443:Gucy1a1 UTSW 3 82097693 missense probably damaging 1.00
R8531:Gucy1a1 UTSW 3 82111161 missense probably benign
R8872:Gucy1a1 UTSW 3 82108742 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTTCGCACCCAGGTTTATCTAAC -3'
(R):5'- AGCCATGTAGGCAGACATGAATGAC -3'

Sequencing Primer
(F):5'- GGGGTTACTCTGCATTAACACAC -3'
(R):5'- gcagacatgaatgacaaagcc -3'
Posted On2013-11-08