Mutagenetix > Incidental Mutations

Incidental Mutation 'R0907:Unc5c'

83350

Institutional Source

Beutler Lab

Gene Symbol

Unc5c

Ensembl Gene

ENSMUSG00000059921

Gene Name

unc-5 netrin receptor C

Synonyms

B130051O18Rik, Unc5h3

MMRRC Submission

039065-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141465216-141834924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141789033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 369 (Q369R)

Ref Sequence

ENSEMBL: ENSMUSP00000117487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]

AlphaFold

O08747

Predicted Effect

probably benign
Transcript: ENSMUST00000075282
AA Change: Q443R

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: Q443R

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	396	418	N/A	INTRINSIC
ZU5	547	650	6.92e-63	SMART
low complexity region	695	704	N/A	INTRINSIC
DEATH	857	948	6.68e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106236
AA Change: Q424R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: Q424R

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	377	399	N/A	INTRINSIC
ZU5	528	631	6.92e-63	SMART
low complexity region	676	685	N/A	INTRINSIC
DEATH	838	929	6.68e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123631

Predicted Effect

probably damaging
Transcript: ENSMUST00000130636
AA Change: Q369R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: Q369R

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
IGc2	105	172	2.72e-5	SMART
TSP1	189	240	8.54e-13	SMART
TSP1	245	294	1.18e-6	SMART
transmembrane domain	322	344	N/A	INTRINSIC
ZU5	473	576	6.92e-63	SMART
low complexity region	621	630	N/A	INTRINSIC
DEATH	783	874	6.68e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142762
AA Change: Q443R

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: Q443R

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	396	418	N/A	INTRINSIC
ZU5	547	650	6.92e-63	SMART
low complexity region	695	704	N/A	INTRINSIC
DEATH	857	948	6.68e-24	SMART

Meta Mutation Damage Score

0.1074

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl2	G	A	1: 156,629,859	V225M	probably damaging	Het
Afmid	T	A	11: 117,835,590		probably benign	Het
Ccdc191	G	A	16: 43,915,538	V216I	probably benign	Het
Cep112	C	A	11: 108,570,432		probably benign	Het
Dcbld1	T	C	10: 52,261,814	V58A	possibly damaging	Het
Dopey2	A	T	16: 93,801,593	H1882L	probably damaging	Het
Fat1	A	G	8: 45,026,598	I2894V	probably benign	Het
Focad	T	C	4: 88,278,261		probably null	Het
Gm45713	G	A	7: 45,132,364	T203M	possibly damaging	Het
Gstm1	T	C	3: 108,017,380	Y28C	probably damaging	Het
Gucy1a1	T	C	3: 82,111,191	D113G	probably benign	Het
Hat1	G	T	2: 71,420,617	E170*	probably null	Het
Herc1	C	A	9: 66,433,428	F1686L	possibly damaging	Het
Iffo1	A	G	6: 125,153,161	E270G	probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrp3	A	T	7: 35,203,293	Y522N	probably damaging	Het
Lrp6	A	T	6: 134,507,525	D378E	probably damaging	Het
Mmrn1	A	G	6: 60,973,119	N351S	probably benign	Het
Olfr1	A	T	11: 73,395,119	L301Q	probably damaging	Het
Olfr1500	T	C	19: 13,827,856	D180G	probably damaging	Het
Pcnx3	T	C	19: 5,671,525	K1082E	possibly damaging	Het
Pikfyve	T	C	1: 65,202,830	V243A	possibly damaging	Het
Qdpr	G	C	5: 45,439,386	I145M	probably benign	Het
Rasgrp3	G	T	17: 75,509,827		probably null	Het
Rd3l	G	T	12: 111,980,140	Y1*	probably null	Het
Sf3b3	A	G	8: 110,811,510		probably benign	Het
Smn1	C	T	13: 100,127,896	T45I	probably damaging	Het
Sprr3	A	T	3: 92,457,009	I176N	probably benign	Het
Sv2c	T	C	13: 96,088,255	D182G	probably damaging	Het
Tnni3k	A	T	3: 154,941,679	V397D	probably damaging	Het
Trpt1	G	T	19: 6,998,940	G235V	possibly damaging	Het
Ttll10	A	T	4: 156,036,164	C367*	probably null	Het

Other mutations in Unc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Unc5c	APN	3	141788940	missense	probably damaging	0.99
IGL01089:Unc5c	APN	3	141818202	splice site	probably benign
IGL01478:Unc5c	APN	3	141828451	missense	probably damaging	1.00
IGL02083:Unc5c	APN	3	141714647	missense	probably damaging	0.99
IGL02269:Unc5c	APN	3	141788982	missense	probably damaging	1.00
IGL02565:Unc5c	APN	3	141803919	missense	probably damaging	1.00
IGL02973:Unc5c	APN	3	141788890	missense	probably benign	0.12
R0179:Unc5c	UTSW	3	141818067	nonsense	probably null
R0309:Unc5c	UTSW	3	141733933	missense	probably benign	0.01
R0371:Unc5c	UTSW	3	141827522	missense	probably benign	0.01
R0603:Unc5c	UTSW	3	141771102	missense	probably damaging	1.00
R0904:Unc5c	UTSW	3	141803840	missense	probably benign	0.08
R1300:Unc5c	UTSW	3	141828543	missense	possibly damaging	0.94
R1491:Unc5c	UTSW	3	141789822	missense	probably damaging	1.00
R1494:Unc5c	UTSW	3	141827549	missense	possibly damaging	0.93
R1674:Unc5c	UTSW	3	141757837	missense	possibly damaging	0.74
R1676:Unc5c	UTSW	3	141757837	missense	possibly damaging	0.74
R1726:Unc5c	UTSW	3	141818103	missense	probably damaging	1.00
R1750:Unc5c	UTSW	3	141827517	missense	possibly damaging	0.89
R1815:Unc5c	UTSW	3	141757757	missense	probably damaging	1.00
R2381:Unc5c	UTSW	3	141678155	missense	probably damaging	1.00
R2394:Unc5c	UTSW	3	141678131	missense	probably damaging	1.00
R2945:Unc5c	UTSW	3	141789974	missense	probably damaging	0.97
R4284:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4285:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4287:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4681:Unc5c	UTSW	3	141768613	critical splice donor site	probably null
R4736:Unc5c	UTSW	3	141816931	missense	probably benign	0.00
R4740:Unc5c	UTSW	3	141816931	missense	probably benign	0.00
R4774:Unc5c	UTSW	3	141828517	missense	probably damaging	1.00
R4862:Unc5c	UTSW	3	141789773	missense	probably damaging	1.00
R4905:Unc5c	UTSW	3	141801310	missense	probably benign	0.19
R4921:Unc5c	UTSW	3	141788966	missense	probably damaging	1.00
R5150:Unc5c	UTSW	3	141757793	missense	probably damaging	1.00
R5559:Unc5c	UTSW	3	141803787	missense	probably damaging	1.00
R5562:Unc5c	UTSW	3	141768530	missense	probably damaging	1.00
R5643:Unc5c	UTSW	3	141678125	missense	probably damaging	1.00
R5644:Unc5c	UTSW	3	141678125	missense	probably damaging	1.00
R5775:Unc5c	UTSW	3	141828520	missense	probably damaging	1.00
R5912:Unc5c	UTSW	3	141789006	missense	probably damaging	1.00
R6154:Unc5c	UTSW	3	141678153	missense	probably damaging	0.97
R6547:Unc5c	UTSW	3	141790019	missense	probably benign	0.16
R6558:Unc5c	UTSW	3	141789729	missense	probably damaging	0.98
R7104:Unc5c	UTSW	3	141733904	missense	probably damaging	1.00
R7113:Unc5c	UTSW	3	141801293	missense	probably benign	0.00
R7282:Unc5c	UTSW	3	141677990	missense	probably damaging	0.98
R7317:Unc5c	UTSW	3	141789942	missense	probably benign	0.00
R7787:Unc5c	UTSW	3	141768552	missense	probably damaging	1.00
R7873:Unc5c	UTSW	3	141827549	missense	probably benign	0.04
R7896:Unc5c	UTSW	3	141771161	missense	possibly damaging	0.73
R7936:Unc5c	UTSW	3	141828477	missense	possibly damaging	0.48
R8041:Unc5c	UTSW	3	141465784	missense	possibly damaging	0.92
R8277:Unc5c	UTSW	3	141768612	critical splice donor site	probably null
R8669:Unc5c	UTSW	3	141803943	missense	possibly damaging	0.91
R8886:Unc5c	UTSW	3	141803820	missense	probably benign	0.02
R8989:Unc5c	UTSW	3	141803706	splice site	probably benign
R9244:Unc5c	UTSW	3	141827609	missense	probably benign	0.00
R9444:Unc5c	UTSW	3	141801448	critical splice donor site	probably null
X0018:Unc5c	UTSW	3	141714739	missense	probably damaging	1.00
X0065:Unc5c	UTSW	3	141827661	missense	probably damaging	1.00
Z1088:Unc5c	UTSW	3	141733900	missense	probably damaging	1.00
Z1176:Unc5c	UTSW	3	141678010	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGACTCAGATGATGTGGCTCTC -3'
(R):5'- TGCAGGTGGACAGATCAAAGGCTC -3'

Sequencing Primer
(F):5'- ACCGTGACTTTGAGTCTGAC -3'
(R):5'- TGCCTTGGGATCTAATCATGAC -3'

Posted On

2013-11-08