Incidental Mutation 'R0907:Qdpr'
ID83354
Institutional Source Beutler Lab
Gene Symbol Qdpr
Ensembl Gene ENSMUSG00000015806
Gene Namequinoid dihydropteridine reductase
Synonyms
MMRRC Submission 039065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R0907 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45434021-45450236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 45439386 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 145 (I145M)
Ref Sequence ENSEMBL: ENSMUSP00000015950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000117425] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
Predicted Effect probably benign
Transcript: ENSMUST00000015950
AA Change: I145M

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806
AA Change: I145M

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117425
AA Change: I93M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112469
Gene: ENSMUSG00000015806
AA Change: I93M

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118097
AA Change: I93M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806
AA Change: I93M

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120867
AA Change: I93M

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806
AA Change: I93M

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127562
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149290
Predicted Effect probably benign
Transcript: ENSMUST00000154962
AA Change: I145M

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806
AA Change: I145M

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196216
Predicted Effect probably benign
Transcript: ENSMUST00000197946
AA Change: I145M

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806
AA Change: I145M

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198258
AA Change: I43M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806
AA Change: I43M

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200259
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
PHENOTYPE: A portion of mice homozygous for a knock-out allele display abnormal rib-sternum attachment, a split xiphoid process, and lumbar vertebral transformation. Another knock-out allele exhibits abnormal folate and biopterin metabolism and oxidative stress in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,629,859 V225M probably damaging Het
Afmid T A 11: 117,835,590 probably benign Het
Ccdc191 G A 16: 43,915,538 V216I probably benign Het
Cep112 C A 11: 108,570,432 probably benign Het
Dcbld1 T C 10: 52,261,814 V58A possibly damaging Het
Dopey2 A T 16: 93,801,593 H1882L probably damaging Het
Fat1 A G 8: 45,026,598 I2894V probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gm45713 G A 7: 45,132,364 T203M possibly damaging Het
Gstm1 T C 3: 108,017,380 Y28C probably damaging Het
Gucy1a1 T C 3: 82,111,191 D113G probably benign Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Herc1 C A 9: 66,433,428 F1686L possibly damaging Het
Iffo1 A G 6: 125,153,161 E270G probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrp3 A T 7: 35,203,293 Y522N probably damaging Het
Lrp6 A T 6: 134,507,525 D378E probably damaging Het
Mmrn1 A G 6: 60,973,119 N351S probably benign Het
Olfr1 A T 11: 73,395,119 L301Q probably damaging Het
Olfr1500 T C 19: 13,827,856 D180G probably damaging Het
Pcnx3 T C 19: 5,671,525 K1082E possibly damaging Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rd3l G T 12: 111,980,140 Y1* probably null Het
Sf3b3 A G 8: 110,811,510 probably benign Het
Smn1 C T 13: 100,127,896 T45I probably damaging Het
Sprr3 A T 3: 92,457,009 I176N probably benign Het
Sv2c T C 13: 96,088,255 D182G probably damaging Het
Tnni3k A T 3: 154,941,679 V397D probably damaging Het
Trpt1 G T 19: 6,998,940 G235V possibly damaging Het
Ttll10 A T 4: 156,036,164 C367* probably null Het
Unc5c A G 3: 141,789,033 Q369R probably damaging Het
Other mutations in Qdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Qdpr APN 5 45434676 missense possibly damaging 0.93
R1387:Qdpr UTSW 5 45450138 start gained probably benign
R1964:Qdpr UTSW 5 45439318 missense possibly damaging 0.58
R2431:Qdpr UTSW 5 45444730 missense probably damaging 1.00
R4586:Qdpr UTSW 5 45439327 missense possibly damaging 0.60
R5678:Qdpr UTSW 5 45447637 missense possibly damaging 0.65
R5754:Qdpr UTSW 5 45439385 missense probably damaging 0.98
R7392:Qdpr UTSW 5 45439376 missense probably benign 0.37
R7939:Qdpr UTSW 5 45450065 missense probably damaging 1.00
R8482:Qdpr UTSW 5 45439346 missense probably benign 0.05
R8891:Qdpr UTSW 5 45447640 missense probably damaging 0.99
X0022:Qdpr UTSW 5 45439355 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTCTCAAACTGTCAGCACTC -3'
(R):5'- AATAGCTTGTGGCACCATGCCC -3'

Sequencing Primer
(F):5'- TCAGCACTCAGCAGTGGAC -3'
(R):5'- TGCACTTTTGGAAACCGGC -3'
Posted On2013-11-08